ID: 1113942094

View in Genome Browser
Species Human (GRCh38)
Location 13:114023630-114023652
Sequence TCGTGGGGCTCTCTAAATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 62}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113942089_1113942094 0 Left 1113942089 13:114023607-114023629 CCCAGAACTCTGAGTCAGCGGGA 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1113942094 13:114023630-114023652 TCGTGGGGCTCTCTAAATCCTGG 0: 1
1: 0
2: 0
3: 6
4: 62
1113942090_1113942094 -1 Left 1113942090 13:114023608-114023630 CCAGAACTCTGAGTCAGCGGGAT 0: 1
1: 0
2: 0
3: 5
4: 82
Right 1113942094 13:114023630-114023652 TCGTGGGGCTCTCTAAATCCTGG 0: 1
1: 0
2: 0
3: 6
4: 62
1113942083_1113942094 9 Left 1113942083 13:114023598-114023620 CCTGCCCTCCCCAGAACTCTGAG 0: 1
1: 0
2: 4
3: 45
4: 469
Right 1113942094 13:114023630-114023652 TCGTGGGGCTCTCTAAATCCTGG 0: 1
1: 0
2: 0
3: 6
4: 62
1113942085_1113942094 4 Left 1113942085 13:114023603-114023625 CCTCCCCAGAACTCTGAGTCAGC 0: 1
1: 0
2: 1
3: 32
4: 212
Right 1113942094 13:114023630-114023652 TCGTGGGGCTCTCTAAATCCTGG 0: 1
1: 0
2: 0
3: 6
4: 62
1113942087_1113942094 1 Left 1113942087 13:114023606-114023628 CCCCAGAACTCTGAGTCAGCGGG 0: 1
1: 0
2: 0
3: 11
4: 136
Right 1113942094 13:114023630-114023652 TCGTGGGGCTCTCTAAATCCTGG 0: 1
1: 0
2: 0
3: 6
4: 62
1113942084_1113942094 5 Left 1113942084 13:114023602-114023624 CCCTCCCCAGAACTCTGAGTCAG 0: 1
1: 0
2: 4
3: 35
4: 382
Right 1113942094 13:114023630-114023652 TCGTGGGGCTCTCTAAATCCTGG 0: 1
1: 0
2: 0
3: 6
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113942094 Original CRISPR TCGTGGGGCTCTCTAAATCC TGG Intronic
904702528 1:32366426-32366448 GGAAGGGGCTCTCTAAATCCCGG - Intronic
906978709 1:50604980-50605002 TGGTGGGACTCTCAAAATCAAGG + Intronic
910102476 1:83593693-83593715 TCTTGGGGGTCCCTAATTCCAGG - Intergenic
917112464 1:171562899-171562921 TCTTGGGGCTTTCTGACTCCAGG + Intronic
918712815 1:187752051-187752073 TCGTGGGGTTAGCTAAACCCTGG + Intergenic
1064205027 10:13316087-13316109 TCGTGGAGCTTTCAAAATACAGG + Intergenic
1066175515 10:32900188-32900210 TCCTTGGGCTCTCTGAATCATGG - Intergenic
1080578527 11:33622466-33622488 CTGTGGGGCTCTCTCATTCCTGG - Intronic
1080647756 11:34199252-34199274 TGGTGGGGATCTCAAACTCCAGG - Intronic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1096343946 12:50828716-50828738 TCTTGGGGTTCCCTGAATCCGGG - Intergenic
1108622244 13:52195615-52195637 CCGCGGGGCTCACTACATCCTGG - Intergenic
1109988951 13:70028466-70028488 CCGTGGGTCTCTTTTAATCCAGG - Intronic
1113942094 13:114023630-114023652 TCGTGGGGCTCTCTAAATCCTGG + Intronic
1114138067 14:19876308-19876330 TGCTGGGGCTCTCTAATTCCTGG + Exonic
1114142867 14:19935707-19935729 TTTTGGGACTCTCTAATTCCTGG + Exonic
1115108509 14:29790501-29790523 CCGTGGGGCTGGCTAATTCCAGG - Intronic
1117603875 14:57404846-57404868 TGGTGGGAGTCTCTAAATCATGG - Intronic
1118182923 14:63511285-63511307 TTGTGGGGTTCTCTAAAGCCTGG - Intronic
1120549825 14:85856902-85856924 TCATGGTGGTCTCAAAATCCAGG + Intergenic
1124340863 15:28888456-28888478 TCGAGGGGGTCTCTGAAGCCAGG - Intronic
1124542793 15:30603337-30603359 ACCTGGGGCTCTCAAAGTCCTGG + Intergenic
1130516611 15:84630743-84630765 TCGTGGGCCTCTCAAAGTGCTGG - Intergenic
1133409278 16:5555092-5555114 ATGTGGGGCTCTCTAAAGCCCGG + Intergenic
1135102554 16:19619140-19619162 TCGTGCTGATCTCTAACTCCTGG + Intronic
1135244521 16:20844076-20844098 TCCTGGGGCACTATAAATACAGG - Intronic
1137787341 16:51150336-51150358 TCGTGGTGCTCCCTACTTCCAGG - Intronic
1138732996 16:59216645-59216667 TCGGGGCTCACTCTAAATCCAGG + Intergenic
1145693502 17:26767753-26767775 TTGTGGCTCTCTCTACATCCCGG + Intergenic
1146064323 17:29622846-29622868 TCCTGCGGCTCTCTAGAGCCCGG + Exonic
1148055624 17:44793360-44793382 GCCTGGGCCTCTCAAAATCCTGG - Intergenic
1148805210 17:50260502-50260524 TCGTGGGGCTCTCTGCAGGCGGG + Intergenic
1203190851 17_KI270729v1_random:186906-186928 TTGTGGCTCTCTCTACATCCCGG + Intergenic
1156272239 18:35546225-35546247 TCTTCCAGCTCTCTAAATCCTGG + Intergenic
1157107330 18:44786778-44786800 CCGTGTGGCTCTCTAAACCCAGG - Intronic
1157154336 18:45250667-45250689 TCCTGGGTCTTTCTCAATCCCGG - Intronic
1163334426 19:16661492-16661514 TCGTGGGGTTCTCTCACGCCGGG + Intronic
1163526818 19:17826507-17826529 CAGTGGGGCTCTCTGAGTCCTGG - Exonic
1167205510 19:48098667-48098689 TCGGGGTGGTCTCCAAATCCTGG - Intronic
926954628 2:18280996-18281018 AAGACGGGCTCTCTAAATCCAGG - Intronic
930474864 2:51869019-51869041 GGGTGGGGCTTTCTAAATACTGG - Intergenic
941223976 2:162821815-162821837 TCTTGGTTCTCACTAAATCCTGG + Intronic
947231080 2:227887028-227887050 GAGAGGGGCTCTCTTAATCCTGG + Intronic
1174401812 20:50280015-50280037 TAGTGGGGGTCGATAAATCCAGG - Intergenic
1179576203 21:42310038-42310060 TCGGGGGGCTCTCAGAACCCCGG - Intergenic
1184795055 22:46727503-46727525 TGGTTGGTCTCTCTAACTCCTGG + Intronic
950379402 3:12598485-12598507 TCTTGGGTCTCTCAAAATGCTGG - Intronic
951046575 3:18046285-18046307 TCCTAGTGATCTCTAAATCCTGG + Intronic
959271372 3:104214892-104214914 TGGTGGGTTTCTCTAAAGCCTGG + Intergenic
968671889 4:1856368-1856390 TCCTGGGGCTCGCTGCATCCTGG + Intergenic
985528504 5:420308-420330 TCGTTGGGCTCTGTTAATTCAGG - Intronic
990507963 5:56463497-56463519 TCCTGGGCCTCTCCAAATGCTGG - Intronic
993866344 5:93201028-93201050 TAATTGGGCTCTCTAAAACCTGG + Intergenic
997186248 5:131884725-131884747 TCTTGGGGGTCCCTAATTCCAGG + Intronic
997408478 5:133671207-133671229 TGGTGGGGCTGTCTCATTCCTGG - Intergenic
999982628 5:156972514-156972536 TCCTTGGGCTGTCTACATCCAGG - Intergenic
1014224567 6:118833090-118833112 TCATGTGGCTCTCTGACTCCAGG - Intronic
1022894999 7:34740927-34740949 CCGTGAGCCTCTGTAAATCCTGG + Intronic
1032850245 7:135788854-135788876 CCGTGGCCCTCTCTAAACCCTGG - Intergenic
1039104996 8:33980589-33980611 CCGTGGGGCTCTCCACAGCCTGG + Intergenic
1041248049 8:55907615-55907637 ACGTGGGTCTCTCAAAGTCCTGG - Intronic
1044517406 8:93155266-93155288 TCATGGGGCTCTCACAACCCAGG - Intronic
1048951673 8:139501674-139501696 TCTTGGGGCTCTCTCCATCCTGG + Intergenic
1052937340 9:34103746-34103768 TTGAGGGGATCTCTTAATCCTGG + Intronic
1060522039 9:124299475-124299497 TCCTGGGGCTCTTTATACCCTGG + Intronic
1193085978 X:77448090-77448112 TCGTGGGCCTCTCGACATCAGGG + Intronic
1193274473 X:79570058-79570080 AGGTTGGGCTCTCTAAAGCCTGG + Intergenic
1195618582 X:106931692-106931714 TGGTGGGGCCCTCTAGATCCAGG - Intronic
1199582550 X:149374825-149374847 TCGTGTGGCTCTCAAAATGATGG - Intergenic