ID: 1113942561

View in Genome Browser
Species Human (GRCh38)
Location 13:114025963-114025985
Sequence GTCACAGAGCCCAAAGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 1, 2: 2, 3: 31, 4: 265}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113942552_1113942561 24 Left 1113942552 13:114025916-114025938 CCTGGTGAAAGAGGTCTGCTAAG 0: 1
1: 0
2: 0
3: 3
4: 104
Right 1113942561 13:114025963-114025985 GTCACAGAGCCCAAAGAGCAGGG 0: 1
1: 1
2: 2
3: 31
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113942561 Original CRISPR GTCACAGAGCCCAAAGAGCA GGG Intronic
900313542 1:2046265-2046287 CTCACAGAGCCCAAGGGGCCCGG - Intergenic
900517167 1:3087966-3087988 GGCACCAAGGCCAAAGAGCAGGG - Intronic
900574509 1:3376445-3376467 CTCAGACAGCCCCAAGAGCATGG - Intronic
901706396 1:11076682-11076704 GGCATAGAGACCAATGAGCAAGG - Intronic
903159768 1:21478362-21478384 GTCACAAGGCCCAAAGATTATGG - Intronic
903530928 1:24029885-24029907 ATCACAGAGCCCAGAGGTCAAGG - Intergenic
904739737 1:32664367-32664389 GGCACAGAGCCCACAGAGCAAGG - Intronic
904956799 1:34291388-34291410 CTCACAGACCACAAAGAGCTGGG + Intergenic
907042146 1:51271380-51271402 GTCACTGAGCCCAAAGAGCCAGG + Exonic
907636771 1:56142881-56142903 GACAAAGAGCTCAGAGAGCAAGG - Intergenic
908274558 1:62456754-62456776 GTCAGAGATCCCAGAGAGCCAGG - Intronic
909027939 1:70504557-70504579 GTCACACAGCCCACATATCATGG - Intergenic
909898493 1:81104195-81104217 GTCACAGGCCACAAAGATCATGG - Intergenic
909925791 1:81436473-81436495 GTCACAGAGCCCAGACATTATGG - Intronic
911364606 1:96921817-96921839 GTCATAGAGTCTTAAGAGCATGG - Intergenic
912445739 1:109734809-109734831 GTCAGAGGGCCCAAATGGCAGGG - Exonic
915491664 1:156253336-156253358 GACACAGAGGCAACAGAGCAGGG + Intronic
915705174 1:157836832-157836854 GTCTCAGAGCCCCAAGAGTTTGG + Intronic
916630402 1:166606400-166606422 GAGACAGAGACCAAAGAGAATGG - Intergenic
917438010 1:175040527-175040549 GAGACAGAGAACAAAGAGCAAGG - Intergenic
918070372 1:181129774-181129796 GTCACAGAGGACACAGAGAATGG + Intergenic
918418422 1:184336898-184336920 GTTACAGTGCCCAAATAGCATGG - Intergenic
918656553 1:187033736-187033758 GTCACAAAGCCTCAAAAGCATGG - Intergenic
919471155 1:197980599-197980621 GCCACAGAGCCCAGAGTGCCTGG + Intergenic
923198514 1:231690390-231690412 TTCACAGAGCACAGAGGGCACGG + Intronic
1062839110 10:656873-656895 GTGACTTAGCACAAAGAGCATGG + Intronic
1063287267 10:4703837-4703859 GTTACAGACCCCAAAGGCCATGG + Intergenic
1064356261 10:14621340-14621362 GTCACAGAACACAAATAACAGGG - Intronic
1064560620 10:16591991-16592013 ATCAGAGAGGCCACAGAGCAAGG - Exonic
1067054959 10:43045015-43045037 GTGACTGAGCCCAAAGAGGCAGG + Intergenic
1070129740 10:73648018-73648040 GTCACAGGGCCCGAGGAGCGTGG + Exonic
1070527122 10:77304869-77304891 GTCCAAGACCCCAAAGAGGAAGG + Intronic
1070897510 10:79997207-79997229 ATTACAGAGCAGAAAGAGCAGGG + Intergenic
1071707115 10:88011288-88011310 CTCACAGAGCAGAAAGGGCAAGG + Intergenic
1073573734 10:104603087-104603109 GTCACAGAGAACAAAGTGCTGGG - Intergenic
1075830922 10:125410079-125410101 GTCACAGAACCCCACGAGCAGGG - Intergenic
1076342123 10:129756390-129756412 GTCACAGAGCCCCAAGGTCTCGG + Intronic
1076624929 10:131815943-131815965 GTCAGAGAGCCCATGGGGCAGGG + Intergenic
1076692514 10:132230961-132230983 GTGACAGGGCCCAGAGGGCACGG - Intronic
1076692621 10:132231396-132231418 GACACAGAGCCCAAAGACTCGGG - Intronic
1077268800 11:1665625-1665647 GCCACACAGCCCAAAGAGGCTGG - Intergenic
1078181829 11:9018119-9018141 GTCACAGAGCCCAGAGTCAAGGG + Intergenic
1078186993 11:9060587-9060609 GTCACAGAAGCCAAGAAGCATGG + Intronic
1080262428 11:30364140-30364162 GTCACAGTGTGCAAAGAGCAAGG - Intergenic
1080861331 11:36152791-36152813 GTTACAGAGCAAAAATAGCATGG - Intronic
1081536023 11:43996849-43996871 GTCACCCAGGCTAAAGAGCAAGG + Intergenic
1081862181 11:46339532-46339554 GTCCCAGAGGCCAACGTGCAGGG + Intronic
1082026892 11:47579027-47579049 GACACGGAGCCCCAAGGGCACGG - Exonic
1082830643 11:57614505-57614527 GTCCCAGAGCACGAAGAGGAAGG - Exonic
1082897294 11:58205377-58205399 GGAAGAGAGGCCAAAGAGCAAGG + Intergenic
1082897992 11:58213539-58213561 GGAAGAGAGGCCAAAGAGCAAGG - Intergenic
1083192498 11:61062364-61062386 GTCACAGAGAGGAAAGGGCATGG + Intergenic
1083897463 11:65627261-65627283 GTCACGGGCCCAAAAGAGCAGGG + Intronic
1084421477 11:69062746-69062768 GTCACTGAGCCCAAAGTGGAGGG - Intronic
1084579651 11:70015281-70015303 GTCACTGGGCCCAAAGAGGAGGG - Intergenic
1088420945 11:109646097-109646119 GTCCTAGAGCCCAAAGAGAGAGG + Intergenic
1088598143 11:111455105-111455127 GGCACAGAGACCAGAGAGGAAGG - Intronic
1089615460 11:119692349-119692371 TGCACAGAGCCAAGAGAGCATGG - Intronic
1090111202 11:123911165-123911187 GTCTCAGAGCCCAAGGCCCATGG - Intergenic
1090921912 11:131214358-131214380 GTCACAGGGCAAGAAGAGCAGGG + Intergenic
1093822337 12:23636880-23636902 GTCACAGAGTCCAAAATCCATGG - Intronic
1096717587 12:53500577-53500599 GTCACGGAGGCCCAAGGGCAAGG + Intergenic
1098271824 12:68776906-68776928 GTCAGAGAGCACAAAGATGATGG - Exonic
1098659323 12:73072775-73072797 GTCACAGAGCTCAAGGAGACTGG - Intergenic
1101180394 12:102210594-102210616 GGCACAGAGCTTAAACAGCATGG - Intergenic
1101875698 12:108595821-108595843 GTCACAGACCCCAAAGCTCAAGG - Intronic
1102028324 12:109726062-109726084 GTCACACAGCCTACAGAGAACGG - Intronic
1102193518 12:111007469-111007491 GTCTCAGTGCACAAAGAGCTTGG - Intergenic
1102626820 12:114241901-114241923 GTCACAGCACCTAAAGCGCATGG - Intergenic
1105538566 13:21293446-21293468 GTCACTGAACCCAAAGAACCCGG + Intergenic
1106421655 13:29590483-29590505 GTCACTGAGCGCAAGGTGCATGG + Intronic
1107290861 13:38851721-38851743 GTCACTGAACCCAAAGAACCTGG + Exonic
1110564265 13:76942053-76942075 GTCAGGGTGCCAAAAGAGCAAGG - Intergenic
1112836350 13:103518968-103518990 GTCACAGAGCCAGCAGAGCCTGG - Intergenic
1113942561 13:114025963-114025985 GTCACAGAGCCCAAAGAGCAGGG + Intronic
1114159591 14:20149617-20149639 TTCACAGTGCCCAAAAAGAAGGG + Intergenic
1114491147 14:23102827-23102849 GTCAAAGAACCCACAGAGGATGG - Intergenic
1114894066 14:26963813-26963835 GCAACAGACCACAAAGAGCAGGG - Intergenic
1116412242 14:44638381-44638403 GTCACATAGCCCAAGGGGCAGGG - Intergenic
1117982842 14:61358813-61358835 GGGAAAGAGCCTAAAGAGCAGGG - Intronic
1118242043 14:64069477-64069499 GTCATACAGCCCAAACAGCAGGG + Intronic
1121325656 14:93018230-93018252 GTCACAGCCCCCATGGAGCAGGG + Intronic
1124075133 15:26437034-26437056 GTCAAAGTGACCCAAGAGCAAGG + Intergenic
1125813696 15:42565230-42565252 GTCAAAGAACCCAGAGAGTATGG + Intronic
1126062742 15:44799586-44799608 GACACAGAAAGCAAAGAGCAAGG - Intergenic
1126278611 15:46916076-46916098 GGCACAGTGACCATAGAGCAAGG + Intergenic
1126532271 15:49724346-49724368 GTAACAGATCTCAAAGAACATGG + Intergenic
1127104458 15:55598090-55598112 GCCAGAGAGCATAAAGAGCAAGG - Intergenic
1127178031 15:56382488-56382510 GTCTCAGAGCCCAAGGCCCATGG + Intronic
1127455600 15:59153624-59153646 GTCACAGACGCCAGAGAGCCTGG - Exonic
1127993450 15:64137364-64137386 GTTACTGAGCCCCAAGTGCAAGG - Intronic
1129512982 15:76138534-76138556 GTCACAGAGCCCATAAGGGATGG + Intronic
1129753918 15:78084487-78084509 GTCACACTGCCCCAGGAGCAGGG + Intronic
1131007203 15:88987693-88987715 GTGACAGAGTAGAAAGAGCATGG + Intergenic
1132324679 15:100958863-100958885 GTCCCAGAGCACAGAGAGCCCGG - Intronic
1132646625 16:1002218-1002240 GTGACAGGGCCCTCAGAGCAAGG - Intergenic
1132800862 16:1752306-1752328 GTGGCAGAGCCCAGAGTGCACGG - Intronic
1133454811 16:5932818-5932840 GGCACTGGGGCCAAAGAGCAGGG - Intergenic
1133935530 16:10266056-10266078 GACACAGACACCAAAGAACAGGG - Intergenic
1134092356 16:11398357-11398379 GTCACAGAGCCCCAGGTGGAGGG + Exonic
1134521147 16:14919727-14919749 GGCTCAGAGCCCGGAGAGCAGGG - Intronic
1134716034 16:16358412-16358434 GGCTCAGAGCCCGGAGAGCAGGG - Intergenic
1134950782 16:18350267-18350289 GGCTCAGAGCCCGGAGAGCAGGG + Intergenic
1134958722 16:18393747-18393769 GGCTCAGAGCCCGGAGAGCAGGG + Intergenic
1136063875 16:27745921-27745943 GTCAAAGAGGTCTAAGAGCAAGG + Intronic
1137931566 16:52592852-52592874 GTCTCAGTGCCCAAGGATCATGG - Intergenic
1138164086 16:54783741-54783763 TTCACTGAGCCCAAATACCAGGG - Intergenic
1138356619 16:56386254-56386276 GCCTCAGAGACCAAAGACCAAGG - Intronic
1138375681 16:56562411-56562433 GTCCCAGGGCCAAGAGAGCACGG - Intergenic
1138395180 16:56698497-56698519 GTCACAGAGCAGAAAGAGAAGGG + Intronic
1138553059 16:57757667-57757689 GTCGCAGTGCCCACGGAGCAGGG - Intergenic
1140778386 16:78271845-78271867 GTCACACAGCCCAAAGAGCATGG + Intronic
1141915174 16:87091470-87091492 GTCACATAGCTCAAAGATGAGGG - Intronic
1141915192 16:87091650-87091672 GTCACATAGCTCAAAGATGAGGG - Intronic
1144471607 17:15547449-15547471 GTCACAGTAACCAAATAGCAAGG - Intronic
1144924870 17:18797256-18797278 GTCACAGTAACCAAATAGCAAGG + Intronic
1145904292 17:28507853-28507875 CTCACAGAGCCACAAGAGAAAGG - Intronic
1146465695 17:33084458-33084480 GTGGCAGAGCAGAAAGAGCATGG + Intronic
1146582412 17:34050498-34050520 ATCACAGAACTCAAAGATCAGGG + Intronic
1146632398 17:34480207-34480229 GTCAATAAGCCCAAAGAGGATGG - Intergenic
1146942311 17:36851814-36851836 GCCATAGGGCCCAGAGAGCATGG - Intergenic
1147958275 17:44150022-44150044 GGCACAGAGGCAGAAGAGCAAGG + Intronic
1149445107 17:56707472-56707494 AACACAGCCCCCAAAGAGCAGGG - Intergenic
1149468730 17:56899420-56899442 GTCTCAGAGGCCACAGAGCTGGG - Intronic
1150510322 17:65745466-65745488 GTCACAGAGCCAGAGGAGCCAGG + Intronic
1151952373 17:77362212-77362234 GCTACAGAGCCCAAAGGGCAGGG - Intronic
1151953074 17:77365961-77365983 GCCTCAGACCCCACAGAGCAGGG + Intronic
1152360905 17:79832592-79832614 GGGAGAGAGCCCGAAGAGCAAGG + Intergenic
1153948637 18:10038591-10038613 GTCCCTGAGCACAAATAGCAGGG - Intergenic
1154411215 18:14143216-14143238 GGCCCAGAGCCCCAAGAGCTGGG + Intergenic
1156142694 18:34135446-34135468 GTCTCAGCCTCCAAAGAGCAGGG - Intronic
1156977261 18:43237976-43237998 GTCTCAGAGCCCAAAGCCCATGG + Intergenic
1157702108 18:49767941-49767963 GTCACAAAGCCCCGAGAGCTGGG - Intergenic
1158216228 18:55103310-55103332 GTCAAAGAGCCCAGAGGGCAGGG + Intergenic
1158890036 18:61864168-61864190 GTCACAGACCCCACAGGTCAGGG + Intronic
1161572008 19:5035932-5035954 CTCACACAGCCCAGAGAGCTTGG + Intronic
1161931730 19:7345141-7345163 GTCACAGGACCCAAAGTGCTGGG - Intergenic
1165020709 19:32921786-32921808 GTCACAGAGCACCAAGACCCAGG + Intronic
1165727462 19:38123222-38123244 TGCCCAGAGCCCAAAGAGCCTGG + Intronic
1167446575 19:49541393-49541415 GTGCCAGAGCCCAAACACCAAGG - Intronic
1167749080 19:51368984-51369006 GACACAGAGCCCAGAGAGACGGG + Exonic
925976162 2:9143552-9143574 GTCAGAGGGTCCCAAGAGCAGGG + Intergenic
926223941 2:10954368-10954390 GACACAGACATCAAAGAGCAAGG - Intergenic
926515198 2:13835966-13835988 GTCACAGAACACAACAAGCAAGG - Intergenic
928104554 2:28459908-28459930 GTCTTAGAGCCCACATAGCAAGG + Intronic
928373985 2:30760332-30760354 CTGACAGAGCCCATGGAGCAGGG + Intronic
929587681 2:43126649-43126671 GTCCCTGAGCCCAGGGAGCAGGG + Intergenic
929775791 2:44929750-44929772 GGCACGGAGCCCACAGAGCGAGG + Intergenic
930485978 2:52011802-52011824 GTAATAGAGGCCACAGAGCAAGG - Intergenic
930944898 2:57061691-57061713 GTCTCAGAGCCCAAGGTCCACGG + Intergenic
931166145 2:59750884-59750906 CTCACAGAGCATAAAGAGAAAGG - Intergenic
936375010 2:111933179-111933201 GACACTGAGCCCCATGAGCAGGG + Intronic
936385025 2:112021607-112021629 GTCCCACAGCACAAAGAGGAGGG + Intronic
937224582 2:120360899-120360921 GGTACAGACCCCAAAGACCAGGG - Intergenic
937227126 2:120376335-120376357 GTGACTTAGCCCAGAGAGCATGG + Intergenic
937376419 2:121338809-121338831 GTCAAAGAGCTCAAGGAGAAAGG + Exonic
942707061 2:178786056-178786078 GTCAGAGAGCCCAGAGAGCCTGG - Exonic
942943538 2:181647749-181647771 GTAACAGACCCCAAAGAAAAGGG + Intronic
943601769 2:189930185-189930207 GTCACTAAGCCCAAAGAACCAGG - Intronic
944043499 2:195382384-195382406 GTCACAGAGGAAAATGAGCAAGG + Intergenic
944198932 2:197084836-197084858 ATGACAGAGCCCAAAGATAAAGG + Intronic
944848518 2:203692856-203692878 GTCTCAGAACCCAAAGAGATTGG - Intergenic
945043656 2:205763529-205763551 GTCACAGAGCCTGGAGAACAAGG + Intronic
945224290 2:207517270-207517292 GTAAGAGAGCCCCAAGAGGAAGG - Intergenic
945444226 2:209916730-209916752 TTCACACAGCTCAAAGGGCAAGG + Intronic
1168940368 20:1706557-1706579 CTCACAGATCCTAAAGGGCAGGG - Intergenic
1169931477 20:10837690-10837712 TTCACTGAGCCCAAAGTGAAGGG + Intergenic
1170272775 20:14547105-14547127 GTCACTGAGCCCAAAGAGGCAGG - Intronic
1170674893 20:18469882-18469904 GTCACAGAGCCCAGTCATCAGGG + Intronic
1170890992 20:20375178-20375200 GTCACAGAGCCTCATGAGAAGGG + Intergenic
1171227840 20:23456196-23456218 GTCACAGAGGACAAATAGCATGG - Intergenic
1173344520 20:42186528-42186550 GTCACGGAGCTCACAGAGAAAGG + Intronic
1174445830 20:50590501-50590523 GGCCCAGAGCCAAAAGAGAATGG + Intronic
1174548393 20:51343617-51343639 GGCAGGGAGCCCACAGAGCAGGG + Intergenic
1174736586 20:52971666-52971688 GACACAGAGGCCACAGAGAAAGG - Intergenic
1175215418 20:57389789-57389811 CTCGCAGCGCCCAAATAGCAGGG + Intergenic
1175928956 20:62484621-62484643 GTCCCAGAGCCCAAGAGGCAGGG - Intergenic
1176861841 21:14015201-14015223 GGCCCAGAGCCCCAAGAGCTGGG - Intergenic
1178405884 21:32322903-32322925 GTCACACATCCCACAGATCAGGG + Intronic
1179634271 21:42697226-42697248 GACAAAGGGCCCAAAGTGCAGGG + Intronic
1179910992 21:44448819-44448841 CTCACAGAGGGCAAAGGGCAAGG - Intergenic
1180997724 22:19973753-19973775 GCCACAGTGCGCAAAGAGCGCGG - Exonic
1181090512 22:20469345-20469367 GTCACAGGACACACAGAGCAGGG + Intronic
1181484747 22:23223652-23223674 GTCACAGATCCCACAGAGCCAGG - Intronic
1182844453 22:33418906-33418928 GTCAGAGAGTCCAGAGGGCATGG + Intronic
1183038733 22:35160242-35160264 GTCACAGAGCCCAGAGTCAAGGG - Intergenic
1183124570 22:35763674-35763696 TTCACAAAACCCAAAGAGGAAGG + Intronic
1185367004 22:50441377-50441399 GGCCCAGAGCCCCAAGAGCTGGG - Intronic
950017717 3:9765954-9765976 GTCACAGAACCCATAGGGAATGG - Exonic
950611880 3:14132258-14132280 ATCTCTGAGCCCAAAGGGCAGGG + Intronic
950671154 3:14526116-14526138 GTTACTCAGCCCCAAGAGCAGGG - Intronic
951482108 3:23172267-23172289 GAAACAGAGACCAAAGAGCAAGG + Intergenic
951847219 3:27097408-27097430 GTCACAGAGCCCACTGAGTAAGG - Intergenic
952563136 3:34619931-34619953 GTCAGAGAGCCCACATATCACGG + Intergenic
954224990 3:49175613-49175635 TCCACAGAGCCCAAAGGACATGG - Exonic
954947091 3:54435209-54435231 GTTACTGACCCCAAAGGGCAGGG - Intronic
955848505 3:63194328-63194350 CTCACAGAACCCAAAGACCGTGG + Intergenic
956789856 3:72672178-72672200 GTCCCAGAGGACAAAGAGGAGGG + Intergenic
958850209 3:99315868-99315890 GTCACAGAGCCCAAATTTAAGGG - Intergenic
959209301 3:103356611-103356633 GCCACATAGCCCAAGAAGCAGGG - Intergenic
959859082 3:111196222-111196244 ATTACATACCCCAAAGAGCATGG - Intronic
960160249 3:114342967-114342989 GGCACAGAAACCAAACAGCAAGG + Intronic
960427338 3:117525071-117525093 GTGATATAGCCCACAGAGCAGGG + Intergenic
961108296 3:124260827-124260849 GTCAGAGAAGCAAAAGAGCATGG - Intronic
962420994 3:135229149-135229171 GGCAGACAGCCCAGAGAGCAGGG + Intronic
963079383 3:141376845-141376867 GTCACAGAGTACAAAGTTCAAGG + Intronic
966622367 3:181979651-181979673 GTCACTGGTCCCAATGAGCAGGG + Intergenic
968278607 3:197459124-197459146 CTCACAGAACCCACAGAGCCAGG + Intergenic
968742782 4:2339870-2339892 CTCACAGGGCCCCAGGAGCAGGG + Intronic
968934727 4:3604071-3604093 GGCACACAGCCCAAAGAACAAGG + Intergenic
969850700 4:9954287-9954309 TTCACACAGCCCAAAGGGCCTGG + Intronic
971249057 4:24956952-24956974 GTCACATAGCTCAAATAGCAGGG - Intronic
974298990 4:60040685-60040707 GTCTCAGAGCCCAAGGCCCATGG + Intergenic
975116615 4:70687901-70687923 GTCACCGAGCCCTGTGAGCAGGG + Intergenic
979878558 4:125925793-125925815 GTCACAGACACCAAAGATCCAGG + Intergenic
981625331 4:146748157-146748179 GGCACAGGCCCCACAGAGCAAGG - Intronic
984288423 4:177762875-177762897 GTCACATAGCTCAAATGGCAGGG + Intronic
984726630 4:183028285-183028307 GTCCCAGAGTCCAAAGAACCTGG + Intergenic
985774306 5:1832830-1832852 GCCACAGAGCCCACAGGGCATGG + Intergenic
988179370 5:27769993-27770015 GTCACAGAGGGCTAAGAGTAAGG - Intergenic
990968115 5:61471569-61471591 GTCATGGAGCTCATAGAGCAAGG + Intronic
994062629 5:95497454-95497476 ACAACAGAGACCAAAGAGCAGGG + Exonic
996192565 5:120563883-120563905 ATCTCAGAGCCCAAAGCACATGG + Intronic
998523709 5:142823483-142823505 GTCACACAGTCCCAAGAGCCAGG - Intronic
999189964 5:149739875-149739897 TTCACAGAGCTCAGAGAGGAGGG + Intronic
1001784632 5:174401529-174401551 GTCACTGGGCCAAGAGAGCAAGG - Intergenic
1003617457 6:7668511-7668533 TTCACAGAGCCGAAGGGGCATGG + Intergenic
1005157075 6:22819362-22819384 GTCTCAGAGCCCAAGGCCCATGG + Intergenic
1005843032 6:29756811-29756833 TTCAAAGAGCCCAAGAAGCAGGG - Intergenic
1006645139 6:35510633-35510655 CTCACAGAGCTCAAGGGGCAGGG + Intronic
1007139662 6:39558592-39558614 CTCACAAAACCCAAAGAGCAAGG + Intronic
1007207790 6:40166627-40166649 GTCACAGAGCTCAAAAAGGACGG - Intergenic
1009792642 6:68422790-68422812 GTCTCAGAGCACAGAGAGAAGGG - Intergenic
1010313713 6:74420391-74420413 GTCTCAGAGCCCAAAGTCCATGG - Intergenic
1012233447 6:96786509-96786531 GTCACAGGGCAGAAAGAGAAGGG + Intergenic
1015600953 6:134909922-134909944 GTCACAGAGCCCGAAGCTCTGGG - Intergenic
1015920800 6:138264672-138264694 GTCTCAGCCCTCAAAGAGCAGGG - Intronic
1016874230 6:148848967-148848989 GTCCTAGAGTCCAAAGACCAAGG + Intronic
1017896143 6:158681783-158681805 CTCCAAGAGCCCACAGAGCAGGG - Intronic
1018785243 6:167103101-167103123 ATCACCGAGTCCAGAGAGCAAGG - Intergenic
1018846172 6:167558237-167558259 GTCAGAGATCCTACAGAGCAGGG - Intergenic
1019058136 6:169237292-169237314 GTCACAGAGCATGAAGACCAAGG + Exonic
1020093991 7:5357566-5357588 GTCACAGAGCCCAGAGGTCGAGG - Intronic
1022227855 7:28382096-28382118 GTCCCAGAGTCCAAAGGCCAGGG + Intronic
1023898180 7:44452422-44452444 GTCTCAGAGACAAAAGAGAAGGG + Intronic
1024166621 7:46739687-46739709 GTTACAGAGCCAAAATAACAGGG + Intronic
1024842180 7:53600087-53600109 CTCACAGATACCACAGAGCAGGG + Intergenic
1026043603 7:66889170-66889192 TCCAAAGAGCCCTAAGAGCAAGG + Intergenic
1026673725 7:72412032-72412054 GGCACAGAAACTAAAGAGCATGG - Intronic
1026972081 7:74474587-74474609 GTCACACAGCACAAAGAGTCAGG - Intronic
1028546943 7:92012722-92012744 GTCATAGAACCCACAGAGGAAGG + Intronic
1030117428 7:106072593-106072615 GTCACAGAAACCGAAGGGCAGGG + Intergenic
1030213376 7:107018677-107018699 GTGAAAGAGCAAAAAGAGCATGG + Intergenic
1030386353 7:108872133-108872155 GTCTCAGCTCCCAAAGTGCAGGG + Intergenic
1030461408 7:109840348-109840370 CTCACAAGGCCCAAAGAGGAGGG - Intergenic
1031992270 7:128206250-128206272 GCCACACAGGCCAAAGAGCCTGG - Intergenic
1034297348 7:149986099-149986121 GTCACAGAGCAGACAGACCATGG - Intergenic
1034479516 7:151308651-151308673 GTCACAGAGCCAAAGCAGGATGG - Intergenic
1034686525 7:152976179-152976201 GTCAAAGGGGGCAAAGAGCATGG + Intergenic
1034808676 7:154110755-154110777 GTCACAGAGCAGACAGACCATGG + Intronic
1034990897 7:155547608-155547630 GTCACTGACCCCTAAGAGCAGGG - Intergenic
1035441215 7:158902624-158902646 TACACAGAGCCCTAAGAGCACGG - Intronic
1035948965 8:3997756-3997778 TTTCCAGAGCCAAAAGAGCAAGG + Intronic
1037779916 8:21860900-21860922 GACACAGTGCGCAGAGAGCATGG + Intergenic
1038847866 8:31246466-31246488 GTCTCTGAGCCAAGAGAGCAGGG - Intergenic
1039414880 8:37385405-37385427 ATGGCAGTGCCCAAAGAGCAAGG - Intergenic
1040443855 8:47473440-47473462 TTCACAGAGCCCACAAAGCGGGG - Intronic
1040972011 8:53145449-53145471 GTCACAGAGGATAAAGAGAATGG + Intergenic
1043014311 8:74919577-74919599 GTCACAGAGCACAAGGCTCATGG - Intergenic
1044514632 8:93123802-93123824 GTCTGAGATACCAAAGAGCAAGG - Intergenic
1046525669 8:115379150-115379172 CTCACAGATCACAAAGAGCCAGG - Intergenic
1046564269 8:115878647-115878669 AACACAGAGCCCACAGGGCAAGG - Intergenic
1048363987 8:133722350-133722372 TTCATAGGGACCAAAGAGCATGG - Intergenic
1048591108 8:135821638-135821660 CACTCAGAGCCCAAAGAGGAGGG + Intergenic
1048776242 8:137949781-137949803 CTCACATAGCAGAAAGAGCAAGG + Intergenic
1048937989 8:139372806-139372828 GTCAAAGAGCCAAAGGAGAATGG + Intergenic
1049101123 8:140579847-140579869 GTCACAGAGCTCTAGGCGCAAGG + Intronic
1049101575 8:140583164-140583186 GTCCTAGAGCCCAAAGGCCAAGG - Intronic
1049350346 8:142160938-142160960 GTCACAGAGGCCACAGGGCATGG - Intergenic
1050218803 9:3362078-3362100 ATCACAGAGAACAAAAAGCATGG + Intronic
1050673583 9:8026031-8026053 GTCACAGAGCAAAAAGAATATGG - Intergenic
1052383125 9:27793327-27793349 GTCCAAGATCCCAAAGAGAAGGG + Intergenic
1052823101 9:33154989-33155011 GTCACTGGGCCCTAAGAGCCAGG - Intronic
1054455440 9:65427910-65427932 GGCACACAGCCCAAAGAACAAGG - Intergenic
1057070552 9:92095783-92095805 GTCAAAGAGATCAAAGAGAAAGG + Intronic
1058845383 9:108952724-108952746 AGCACAGAGGCCACAGAGCAGGG - Intronic
1059636208 9:116173401-116173423 GTCACAGAGCTAACAGAGCCAGG - Intronic
1059779556 9:117512132-117512154 GTCACAGATCACAAGGACCAAGG + Intergenic
1060423449 9:123485942-123485964 GTCACAGAGCCCATGGGCCAGGG - Intronic
1061006264 9:127929923-127929945 GTCACAGAGGAAAAAGATCAGGG + Intronic
1062417248 9:136457874-136457896 GTCACAACGCCCCAAGAGCACGG + Intronic
1188926817 X:36053981-36054003 TTCACAGATCCCAAAGAGGATGG - Intronic
1189241380 X:39527166-39527188 GTCACAGTGTCAGAAGAGCATGG - Intergenic
1189246998 X:39570956-39570978 GACACAGAAGTCAAAGAGCATGG + Intergenic
1189290206 X:39879526-39879548 GCCACAGAGCCCAGAGAAAAGGG + Intergenic
1190492959 X:51001215-51001237 GTCCCAGAGTCCAAAGGCCATGG - Intergenic
1190511671 X:51179351-51179373 GTCCCAGAGTCCAAAGGCCAAGG + Intergenic
1194978761 X:100418710-100418732 GTCACACATCCAGAAGAGCAGGG + Intergenic
1199373699 X:147082879-147082901 TTCAAAGATCCCAAAGAGCAGGG - Intergenic
1201697576 Y:16842749-16842771 GGCACAGAGCAAAAAGTGCAGGG - Intergenic