ID: 1113942900

View in Genome Browser
Species Human (GRCh38)
Location 13:114027860-114027882
Sequence CCCCTACGCCACCGTGACGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 30}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113942900_1113942911 28 Left 1113942900 13:114027860-114027882 CCAGCGTCACGGTGGCGTAGGGG 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1113942911 13:114027911-114027933 CCTGGCACTCGACGATGCTGAGG 0: 1
1: 0
2: 0
3: 4
4: 178
1113942900_1113942903 0 Left 1113942900 13:114027860-114027882 CCAGCGTCACGGTGGCGTAGGGG 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1113942903 13:114027883-114027905 TCACATTGCCCATTCACGATGGG 0: 1
1: 0
2: 0
3: 4
4: 52
1113942900_1113942905 4 Left 1113942900 13:114027860-114027882 CCAGCGTCACGGTGGCGTAGGGG 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1113942905 13:114027887-114027909 ATTGCCCATTCACGATGGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 49
1113942900_1113942908 10 Left 1113942900 13:114027860-114027882 CCAGCGTCACGGTGGCGTAGGGG 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1113942908 13:114027893-114027915 CATTCACGATGGGGAGGCCCTGG 0: 1
1: 0
2: 0
3: 8
4: 101
1113942900_1113942902 -1 Left 1113942900 13:114027860-114027882 CCAGCGTCACGGTGGCGTAGGGG 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1113942902 13:114027882-114027904 GTCACATTGCCCATTCACGATGG 0: 1
1: 0
2: 0
3: 3
4: 58
1113942900_1113942904 1 Left 1113942900 13:114027860-114027882 CCAGCGTCACGGTGGCGTAGGGG 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1113942904 13:114027884-114027906 CACATTGCCCATTCACGATGGGG 0: 1
1: 0
2: 0
3: 2
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113942900 Original CRISPR CCCCTACGCCACCGTGACGC TGG (reversed) Exonic
900366945 1:2315257-2315279 CCCCGCCCCCACCGTGCCGCGGG - Intergenic
901526016 1:9823868-9823890 CGCCGCCGCCGCCGTGACGCTGG + Exonic
902367896 1:15989416-15989438 CCCCTACCCCACCCTGGCGCAGG - Intergenic
907576698 1:55533112-55533134 CCACTAAGCCCCCGTGACCCCGG + Intergenic
923059056 1:230453585-230453607 CCCTTACACCACCCTGACCCAGG - Intergenic
1082118814 11:48356409-48356431 CCCCTACCCCAGTGTGAGGCAGG - Intergenic
1087743410 11:101915155-101915177 CCCTTCCGCGCCCGTGACGCGGG + Exonic
1088760270 11:112922739-112922761 CACCTAGGCCACCGTGGTGCTGG + Intergenic
1095977845 12:47951990-47952012 CCCCTTCTCCACAGTGATGCTGG - Intergenic
1096243779 12:49973413-49973435 CGCCAACCCCGCCGTGACGCTGG + Exonic
1102124381 12:110468715-110468737 CCCCTCCCCCACCGTAACTCCGG + Exonic
1102574497 12:113847608-113847630 CCCCCACCCCACCGTGTCCCCGG - Intronic
1113942900 13:114027860-114027882 CCCCTACGCCACCGTGACGCTGG - Exonic
1122228322 14:100292381-100292403 CACCTTCGCCACCGTCACGGTGG - Exonic
1128605424 15:69033216-69033238 GCCCTTGGCCACCATGACGCTGG - Exonic
1142403589 16:89873802-89873824 TCCCTGCGCCCCCGGGACGCCGG - Exonic
1148225805 17:45897039-45897061 CCTCTACGCCACCGTCAAGGAGG - Intronic
1164832619 19:31334153-31334175 CCCCTACGTGACAGTGACGGAGG - Intronic
1166310211 19:41958528-41958550 CCCCTACCCCACCATCACCCTGG - Intronic
1167499123 19:49835750-49835772 CCCCTACGGTACCCTGAGGCTGG - Exonic
1168332982 19:55580487-55580509 CCCCTCCTCCACCGGGACCCAGG - Intronic
931720169 2:65061747-65061769 CACCCACGCCACCCTGAAGCAGG + Intronic
1171499124 20:25579567-25579589 CCCCCACGCCACCCTGCCTCTGG + Intronic
1172187749 20:33041857-33041879 CCCCAACGCCTCCCTGATGCAGG - Intronic
1179963414 21:44785033-44785055 CCACTAAGCCACGGTGACGGGGG - Intronic
969373932 4:6750774-6750796 CCCCAGCCCCACCGTGAGGCAGG - Intergenic
1023819004 7:43969963-43969985 CCCCTAGGCACCCGTGAAGCAGG + Intergenic
1025811349 7:64877624-64877646 CCCCTTCTCCGCCATGACGCAGG - Intronic
1029744057 7:102506923-102506945 CCCCTAGGCACCCGTGAAGCAGG + Intronic
1029762047 7:102606086-102606108 CCCCTAGGCACCCGTGAAGCAGG + Intronic
1062162264 9:135087154-135087176 CCCCGACGCCCCCCTGGCGCTGG + Intronic
1187390655 X:18884559-18884581 CCCCCACCCCACGGTGGCGCTGG - Intergenic