ID: 1113946935

View in Genome Browser
Species Human (GRCh38)
Location 13:114049755-114049777
Sequence CCCCTGCCAGGGGCCTCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 268}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113946935_1113946942 3 Left 1113946935 13:114049755-114049777 CCCTTGGAGGCCCCTGGCAGGGG 0: 1
1: 0
2: 1
3: 27
4: 268
Right 1113946942 13:114049781-114049803 AGAACACAGGAGCGAGACACAGG 0: 1
1: 0
2: 0
3: 16
4: 268
1113946935_1113946943 16 Left 1113946935 13:114049755-114049777 CCCTTGGAGGCCCCTGGCAGGGG 0: 1
1: 0
2: 1
3: 27
4: 268
Right 1113946943 13:114049794-114049816 GAGACACAGGCCTGCCCTGCAGG 0: 1
1: 1
2: 4
3: 45
4: 471
1113946935_1113946944 23 Left 1113946935 13:114049755-114049777 CCCTTGGAGGCCCCTGGCAGGGG 0: 1
1: 0
2: 1
3: 27
4: 268
Right 1113946944 13:114049801-114049823 AGGCCTGCCCTGCAGGACCATGG 0: 1
1: 0
2: 4
3: 34
4: 347
1113946935_1113946945 24 Left 1113946935 13:114049755-114049777 CCCTTGGAGGCCCCTGGCAGGGG 0: 1
1: 0
2: 1
3: 27
4: 268
Right 1113946945 13:114049802-114049824 GGCCTGCCCTGCAGGACCATGGG 0: 1
1: 0
2: 0
3: 24
4: 205
1113946935_1113946941 -10 Left 1113946935 13:114049755-114049777 CCCTTGGAGGCCCCTGGCAGGGG 0: 1
1: 0
2: 1
3: 27
4: 268
Right 1113946941 13:114049768-114049790 CTGGCAGGGGCTGAGAACACAGG 0: 1
1: 0
2: 3
3: 42
4: 444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113946935 Original CRISPR CCCCTGCCAGGGGCCTCCAA GGG (reversed) Intronic