ID: 1113948250

View in Genome Browser
Species Human (GRCh38)
Location 13:114056992-114057014
Sequence CTGTTGTCCTTGGGAACCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 175}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113948243_1113948250 -6 Left 1113948243 13:114056975-114056997 CCCCCTGCTAAGAGGAGCTGTTG 0: 1
1: 0
2: 2
3: 17
4: 140
Right 1113948250 13:114056992-114057014 CTGTTGTCCTTGGGAACCACGGG 0: 1
1: 0
2: 0
3: 14
4: 175
1113948244_1113948250 -7 Left 1113948244 13:114056976-114056998 CCCCTGCTAAGAGGAGCTGTTGT 0: 1
1: 0
2: 0
3: 13
4: 141
Right 1113948250 13:114056992-114057014 CTGTTGTCCTTGGGAACCACGGG 0: 1
1: 0
2: 0
3: 14
4: 175
1113948239_1113948250 10 Left 1113948239 13:114056959-114056981 CCTCTGTCAGGCTGCCCCCCCTG 0: 1
1: 0
2: 6
3: 55
4: 891
Right 1113948250 13:114056992-114057014 CTGTTGTCCTTGGGAACCACGGG 0: 1
1: 0
2: 0
3: 14
4: 175
1113948245_1113948250 -8 Left 1113948245 13:114056977-114056999 CCCTGCTAAGAGGAGCTGTTGTC 0: 1
1: 0
2: 0
3: 9
4: 79
Right 1113948250 13:114056992-114057014 CTGTTGTCCTTGGGAACCACGGG 0: 1
1: 0
2: 0
3: 14
4: 175
1113948238_1113948250 11 Left 1113948238 13:114056958-114056980 CCCTCTGTCAGGCTGCCCCCCCT 0: 1
1: 0
2: 2
3: 31
4: 371
Right 1113948250 13:114056992-114057014 CTGTTGTCCTTGGGAACCACGGG 0: 1
1: 0
2: 0
3: 14
4: 175
1113948246_1113948250 -9 Left 1113948246 13:114056978-114057000 CCTGCTAAGAGGAGCTGTTGTCC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1113948250 13:114056992-114057014 CTGTTGTCCTTGGGAACCACGGG 0: 1
1: 0
2: 0
3: 14
4: 175
1113948242_1113948250 -5 Left 1113948242 13:114056974-114056996 CCCCCCTGCTAAGAGGAGCTGTT 0: 1
1: 0
2: 1
3: 7
4: 141
Right 1113948250 13:114056992-114057014 CTGTTGTCCTTGGGAACCACGGG 0: 1
1: 0
2: 0
3: 14
4: 175
1113948241_1113948250 -4 Left 1113948241 13:114056973-114056995 CCCCCCCTGCTAAGAGGAGCTGT 0: 1
1: 0
2: 2
3: 36
4: 830
Right 1113948250 13:114056992-114057014 CTGTTGTCCTTGGGAACCACGGG 0: 1
1: 0
2: 0
3: 14
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113948250 Original CRISPR CTGTTGTCCTTGGGAACCAC GGG Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900860578 1:5226434-5226456 CAGGTGTCCCTGGGAAGCACTGG + Intergenic
903289221 1:22297322-22297344 CTCTTTTCCTTGGGAACCCAAGG + Intergenic
903662280 1:24985437-24985459 CTGTGGTCCTAGGGAGCCATGGG - Intergenic
905707326 1:40070785-40070807 CTGTTGTCCTTCCCAACCACTGG + Intronic
906836331 1:49086497-49086519 CCGTTGTCCTAGGAAACAACTGG + Intronic
916074732 1:161193787-161193809 CTGGGGTCCTTGGGGACCATGGG - Exonic
917657934 1:177145570-177145592 CTGTTCTCCATAGGACCCACGGG + Intronic
921027688 1:211302719-211302741 CAGTTATCCTTGGGTACCAAGGG + Intronic
921889095 1:220335836-220335858 TTGTTGACTTTGGCAACCACAGG - Intergenic
922796648 1:228342847-228342869 CTGTTCTCCTTGGGAGCCCTGGG - Intronic
1064036944 10:11921695-11921717 CAGTTGTCCTCGGTATCCACAGG - Intronic
1065650077 10:27878943-27878965 CCCTTGTCCTTGTGAACCAAAGG + Intronic
1068507829 10:57925325-57925347 TTGTTGCTCTTGAGAACCACAGG + Intergenic
1068746554 10:60538223-60538245 CTGTTATCCTTGTTCACCACTGG - Intronic
1069009299 10:63353483-63353505 CTGCTTCCTTTGGGAACCACAGG + Intronic
1069729582 10:70602135-70602157 CCTTTGCCCTTGGGTACCACAGG + Intronic
1070278029 10:75026450-75026472 CTCATTTCCCTGGGAACCACAGG + Intronic
1070897370 10:79996263-79996285 CTGTTGTCCTGGGAAACACCTGG - Intergenic
1071387528 10:85137218-85137240 CTCTTTTGCTTGGGAACCAGAGG + Intergenic
1071743723 10:88391330-88391352 CTCTTGACCTTGTGATCCACCGG - Intronic
1072460366 10:95612770-95612792 CTGTGGTGCTTGGCAAACACAGG + Intronic
1075293595 10:121252672-121252694 CTCTTGCCCTTGGGAGCCAAAGG - Intergenic
1076054355 10:127359188-127359210 CTGCTCACCTTGGGGACCACTGG + Intronic
1077498324 11:2897376-2897398 CTGGTATCCTTGGGACCCAGGGG - Intronic
1078580007 11:12532165-12532187 CTGATGACCTTGAGAACCTCAGG + Intergenic
1083427985 11:62599121-62599143 GTGTTGTCCTTGGAAACCCCAGG - Intronic
1083440612 11:62673598-62673620 CAGTCTTGCTTGGGAACCACAGG - Intronic
1085103537 11:73822170-73822192 CTGTGCTCTTTGGGAACCTCTGG + Intronic
1086210222 11:84309251-84309273 CGTCTGTCCTTGGGAATCACTGG + Intronic
1087227061 11:95613278-95613300 CTGGTCTCCTTGGGAAAAACAGG - Intergenic
1087981760 11:104622805-104622827 CTGAAGTCCATGGGGACCACGGG - Intergenic
1088997874 11:115018922-115018944 CAGTTATCCTTGGGAACCCATGG - Intergenic
1089979707 11:122762192-122762214 CTGTTGTCCTTGGGTAAGACAGG + Intronic
1090649404 11:128793264-128793286 TTCTTCTCCTTGGGAACCATGGG - Intronic
1094650379 12:32370139-32370161 CTCTTGACCTTGTGATCCACCGG - Intronic
1097655626 12:62358955-62358977 CAGTTGTTCTTGGTATCCACAGG - Intronic
1097671055 12:62539058-62539080 CTGTTATACTTGGAAAGCACAGG + Intronic
1098758791 12:74397459-74397481 TTTTTGTACTTGAGAACCACTGG - Intergenic
1099050006 12:77770555-77770577 CTGATTTTCTTGGCAACCACTGG - Intergenic
1102829026 12:115978167-115978189 CTCCAGTCCTTGGCAACCACTGG - Intronic
1104644581 12:130487728-130487750 CCCTTGTCCATGAGAACCACAGG + Intronic
1107178565 13:37428907-37428929 CTAGTGTCATTGGGAACCTCTGG + Intergenic
1109081652 13:57910044-57910066 CTCTTGACCTTGTGATCCACCGG - Intergenic
1109934649 13:69265155-69265177 CTATTGTCCTGGGGAACACCTGG - Intergenic
1109961071 13:69631982-69632004 TTGTTTTTCTTTGGAACCACAGG + Intergenic
1113948250 13:114056992-114057014 CTGTTGTCCTTGGGAACCACGGG + Intronic
1114541759 14:23465924-23465946 CTCTTGACCTTGTGATCCACCGG - Intergenic
1119710461 14:76818445-76818467 CTGTTGTGCTTTTGAACTACTGG - Intronic
1121820844 14:96964632-96964654 CTGGTGTCCATGGGAACAAGGGG - Intergenic
1124050238 15:26190233-26190255 CTCTTGCCCTTGGGAATGACTGG + Intergenic
1125323387 15:38512123-38512145 CTGTTGACTTTGAGAAACACTGG + Intronic
1125450011 15:39798377-39798399 CTGTGGGGCATGGGAACCACTGG - Intergenic
1126238155 15:46409737-46409759 CTGAAGACCTTGGGAAACACAGG - Intergenic
1126433127 15:48608061-48608083 CTGTTGTCCAAGAGAATCACTGG + Intronic
1127544160 15:59974682-59974704 CTGATGGCCTTGGAAACCACTGG - Intergenic
1130089434 15:80807630-80807652 CTGTAGTCAGTGGGAGCCACTGG + Intronic
1130688569 15:86060555-86060577 CTCCTGTCCTTGCGATCCACTGG + Intergenic
1131187919 15:90291742-90291764 CAGCTTTCCTTGTGAACCACAGG + Intronic
1132759019 16:1500021-1500043 CTCTTGGCCTTGGGAGCCCCGGG + Intronic
1133585419 16:7189731-7189753 CAGGTGTCTGTGGGAACCACGGG - Intronic
1136173125 16:28499995-28500017 CTGATGTCATTGGGAACCGCTGG - Intronic
1137488782 16:48913526-48913548 CTCCTGTCCATGGGAAGCACAGG + Intergenic
1138654937 16:58485713-58485735 CTGGTTTCCTCGGAAACCACTGG + Intronic
1141441244 16:84030990-84031012 CTGTGGTCCTTGGGAGCCAGGGG - Intronic
1141894050 16:86947196-86947218 CTGGTGTCCTTGGCCACCTCAGG + Intergenic
1142326721 16:89420555-89420577 CTGTTGTCTTAGGGTCCCACAGG + Intronic
1142672290 17:1492754-1492776 CTGTTGTCCCAGGTAACCAGAGG + Exonic
1145255969 17:21322584-21322606 CTGCTGGCCCTGGGCACCACAGG + Intergenic
1147189715 17:38731322-38731344 CTGGGGTTCTAGGGAACCACTGG - Exonic
1152136586 17:78507424-78507446 CTGAAGTGCGTGGGAACCACCGG + Intronic
1153319084 18:3753870-3753892 CTGTTGTCCTTGGGAATCTGTGG + Intronic
1155316290 18:24574451-24574473 CTGTTGTCCTGGGTAACCTGAGG + Intergenic
1156022474 18:32615869-32615891 CTGCTGTCCATGTGATCCACTGG + Intergenic
1156373314 18:36490447-36490469 CTGGTTACCTTGGGACCCACTGG - Intronic
1156530611 18:37811450-37811472 CAGGTATGCTTGGGAACCACAGG + Intergenic
1160807426 19:998619-998641 CTGGTGTCCTCAGGGACCACTGG - Intergenic
1161731540 19:5963985-5964007 CTGTTTTCCTGGGGTACCAGGGG - Intronic
1164758450 19:30708517-30708539 CTGTTGTCCCTGGGGAGGACAGG + Intronic
1164956138 19:32387403-32387425 ATGTTGTCCCTGGGAAGCATGGG - Exonic
1166652223 19:44583092-44583114 CTGTTGTCCTGGGACACCAATGG - Intergenic
1167244688 19:48365815-48365837 CTGTTTTCCTTTGGGGCCACTGG - Exonic
925247883 2:2400932-2400954 CTGTCGTCCCTGGGTCCCACAGG - Intergenic
925454440 2:4003158-4003180 ATGTTGTCCACGTGAACCACGGG + Intergenic
926916683 2:17898998-17899020 CTCTTGACCTTGTGATCCACCGG - Intronic
928609430 2:32977198-32977220 CTGTTGTCCTGGGAAACACCTGG - Intronic
931774246 2:65526468-65526490 CTGTTGTCCTTTGGGAACAATGG + Intergenic
936410909 2:112257299-112257321 CTCTTGACCTTGTGATCCACCGG - Intergenic
936793243 2:116176266-116176288 TTGTTTTCTTTGTGAACCACAGG + Intergenic
937015929 2:118605453-118605475 CTCTGCTCCTTGTGAACCACTGG - Intergenic
937281872 2:120722935-120722957 TTCCTGCCCTTGGGAACCACTGG + Intergenic
942089894 2:172479802-172479824 CTATTGTCCTGAGGAGCCACAGG + Intronic
946740137 2:222793258-222793280 CCTTTCTCCTTGGGAACAACAGG - Intergenic
946947750 2:224839332-224839354 CTCCTGTCCTTGTGATCCACCGG + Intronic
948702961 2:239772234-239772256 CTGTTGTCCCTGGGTACTCCTGG - Intronic
1169204738 20:3733202-3733224 CTGTTGCGCTTCGGGACCACAGG - Intronic
1170191635 20:13650691-13650713 CTGTTGTTATTGGGAACAAAAGG - Intergenic
1170575706 20:17659936-17659958 GTGTTGCCCTTGGCACCCACTGG + Intronic
1173008934 20:39163639-39163661 ATTTTGTCCTTGGAAACCATGGG + Intergenic
1173149017 20:40550138-40550160 CTGATGCCCCTGAGAACCACTGG + Intergenic
1174241845 20:49142518-49142540 CTGCTGTGGTTGAGAACCACTGG - Intronic
1175580863 20:60098045-60098067 CTGTAGTCCCTGGCAATCACTGG + Intergenic
1176701350 21:10055078-10055100 CTTTTGGCCTTGCCAACCACTGG + Intergenic
1177686036 21:24438563-24438585 CTGTTTTCCTAGGTCACCACTGG - Intergenic
1178899725 21:36589232-36589254 GTGCTGTCCTTGGGGACCAAGGG - Intergenic
1184058408 22:42067377-42067399 CTTTGGTCCGTGGGAGCCACTGG - Intronic
1185082473 22:48717694-48717716 CTGTGGTCCCTGGGAAGCACTGG - Intronic
950792620 3:15485575-15485597 CTGATAGACTTGGGAACCACAGG - Intronic
950818876 3:15736817-15736839 TTGTTTTCCTTGGTCACCACAGG + Intronic
952764284 3:36941813-36941835 CTTTTGGCCTTGGGAACCTCAGG + Intronic
953184765 3:40627809-40627831 CAGTTGTCCTTGAAAACCAATGG + Intergenic
955865387 3:63377035-63377057 CAGTTGTACTTGGGAAAAACGGG - Intronic
962363447 3:134760825-134760847 CTGCTGTCCTGGGGCACCTCCGG + Intronic
967194065 3:187011534-187011556 TTGTTGTCCTTGGGAAGCTGAGG + Intronic
967705297 3:192642705-192642727 CTCTTTTCCTTGAGAACCATTGG - Intronic
968292103 3:197546890-197546912 CTGATGCCCTGGGGCACCACAGG - Intronic
973087681 4:46088119-46088141 GTGTTCTCATTGAGAACCACTGG - Intronic
977156794 4:93583953-93583975 CTATTGGATTTGGGAACCACAGG + Intronic
978863749 4:113482067-113482089 CTGATGTCTTTGGCAGCCACTGG + Intronic
980373503 4:131911337-131911359 CTTTTGGCCTTGCCAACCACTGG + Intergenic
981277687 4:142921049-142921071 CTGATGACCTTGAGAAACACAGG + Intergenic
983103149 4:163651383-163651405 CTGATGACCTTTGGAACCAGGGG - Intronic
983712817 4:170740832-170740854 GTGGTGTGCTTTGGAACCACAGG + Intergenic
984265924 4:177497769-177497791 CTAATGTCCTTGGCCACCACAGG - Intergenic
986631832 5:9781651-9781673 CTGTTGTCTTTTGGGAACACAGG - Intergenic
991622342 5:68557968-68557990 ATGTTGCCATTGGGAAACACTGG - Intergenic
993991018 5:94659688-94659710 ATGTGGTCCTTGGGCAGCACTGG + Intronic
998754234 5:145358436-145358458 CTGTTGTCCTGGGAAACACCTGG - Intergenic
999776901 5:154819216-154819238 AAATTGTTCTTGGGAACCACAGG + Exonic
1002421169 5:179149817-179149839 CTGTGCTCCTCGGGAACCAGGGG + Intronic
1003095040 6:3135870-3135892 TTGTTGCTCTTGGGAACCACAGG + Intronic
1003253638 6:4455548-4455570 CTGCTGTGCTTGGGAAACCCTGG - Intergenic
1007440404 6:41854541-41854563 ATTTTGTTCTTGGGAAACACTGG + Intronic
1007642767 6:43355943-43355965 CTGTTGTCTTTGGGAATCCCAGG + Exonic
1009576953 6:65476800-65476822 CTCTTGACCTTGTGATCCACTGG + Intronic
1011462416 6:87618524-87618546 CTGTTTTCCTATGGAACCCCAGG - Intronic
1011713812 6:90083556-90083578 CTATAGTCATTGGGAACCAACGG - Intronic
1011758923 6:90537761-90537783 TTTTTGTCCTTGGGAAACAGGGG - Intronic
1012045700 6:94270223-94270245 CTGTTGCCACTGAGAACCACGGG + Intergenic
1013663996 6:112327990-112328012 CTTTTGTCCTTGGGTCCCACAGG - Intergenic
1014004330 6:116399512-116399534 CTGTAGTCCTTGGGATCCCAGGG - Exonic
1015514866 6:134073666-134073688 CTGGTCTCCATTGGAACCACTGG - Intergenic
1019285144 7:219589-219611 CTGAAGGCCTTGGGAGCCACAGG + Intronic
1022497946 7:30864967-30864989 CTGTTCCCCTTGAGAATCACGGG + Intronic
1023480467 7:40628398-40628420 CTGTTCTCGTTTAGAACCACTGG + Intronic
1023658694 7:42451738-42451760 CTGTTGTCATTGGGGAACCCTGG - Intergenic
1023971935 7:44998278-44998300 CTGTTGGCCTGGGGAAGCAAGGG - Intergenic
1024930872 7:54665505-54665527 CTGTTTTTCTTGGAAACCCCTGG + Intergenic
1026767688 7:73170947-73170969 CTGTTCTGCTTTGGAAGCACTGG + Intergenic
1027044156 7:74980655-74980677 CTGTTCTGCTTTGGAAGCACTGG + Intronic
1027079488 7:75221703-75221725 CTGTTCTGCTTTGGAAGCACTGG - Intergenic
1028019241 7:85749963-85749985 CTGTTGTCCCTGGAAACACCTGG + Intergenic
1029388707 7:100260285-100260307 CTGTTCTGCTTTGGAAGCACTGG - Intronic
1033195231 7:139321790-139321812 CTGCTGTCCTGGGGAAGCAGGGG - Intergenic
1033802787 7:144920520-144920542 TTGTTATCCTTGGCAATCACTGG + Intergenic
1034782548 7:153894149-153894171 TTGTGGTCCTTGGAAACCAAGGG - Intronic
1037726991 8:21490994-21491016 CTGTTGTGCTTGGAAACTGCAGG + Intergenic
1037817130 8:22118241-22118263 CAGCTGGACTTGGGAACCACGGG + Intronic
1037922094 8:22814655-22814677 CTGTGGTCATTGTGAACCACAGG + Intronic
1039271490 8:35886082-35886104 CTGTTTTACTTGGAAACCAGGGG - Intergenic
1041225343 8:55692095-55692117 CTGTTTTCCTCCTGAACCACTGG + Intergenic
1043521653 8:81052824-81052846 CTGTTGTTCTTGGAAAACAAAGG + Intronic
1048330951 8:133470586-133470608 CTGAGCTCCTTGGGAAGCACGGG + Intronic
1051293574 9:15570624-15570646 CTGTTTTTCTAGAGAACCACTGG + Intronic
1052346806 9:27417833-27417855 CTCTTGGCCTTGTGATCCACCGG - Intronic
1052356088 9:27506144-27506166 AAGTTTTTCTTGGGAACCACTGG + Intronic
1053638493 9:40041621-40041643 CTTTTGGCCTTGCCAACCACTGG + Intergenic
1053767589 9:41423571-41423593 CTTTTGGCCTTGCCAACCACTGG - Intergenic
1054319289 9:63638164-63638186 CTTTTGGCCTTGCCAACCACTGG + Intergenic
1054546258 9:66335087-66335109 CTTTTGGCCTTGCCAACCACTGG - Intergenic
1055329586 9:75169999-75170021 CTCTTGACCTTGTGATCCACTGG - Intergenic
1055668349 9:78574611-78574633 CTGTTGTCTTTGGCAAGCCCTGG + Intergenic
1056182790 9:84102094-84102116 CCATTGTCCCTGGGAACCACTGG + Intergenic
1059806207 9:117803215-117803237 CTGCTATCCTTTGGAAGCACAGG - Intergenic
1060505928 9:124198510-124198532 GTGTTGAACTTGGGAACCTCAGG + Intergenic
1061288747 9:129639120-129639142 CTGTTGTCCTGGGGCACCCTGGG + Intronic
1061639554 9:131941546-131941568 CTGTTGTCGTTGTTTACCACTGG - Intronic
1062383169 9:136297501-136297523 CTGGTGACCTTGGCCACCACTGG - Intronic
1062440254 9:136566511-136566533 CTGTGCTCCTTGGGACCCGCTGG - Intergenic
1202786367 9_KI270719v1_random:25161-25183 CTTTTGGCCTTGCCAACCACTGG + Intergenic
1203779016 EBV:90448-90470 CTGTTGTCCTTGGTTAGCCCCGG + Intergenic
1185654561 X:1673678-1673700 CTTTTGTCCTTGGAAAACATTGG - Intergenic
1187547841 X:20269228-20269250 CTGTTAACCTTGAGAACCAGAGG + Intergenic
1192849723 X:74942322-74942344 CTGTTGTCCTGGGAAACACCTGG - Intergenic
1194012980 X:88584700-88584722 CTGTTATCCTTGGAAACACCTGG + Intergenic
1199613879 X:149639946-149639968 CTGCAGTCCTTAGGAAACACAGG + Intergenic
1199627888 X:149757702-149757724 CTGCAGTCCTTAGGAAACACAGG + Intergenic
1199712408 X:150479007-150479029 CTGTTGAATTTGGGAAACACAGG + Intronic
1201784352 Y:17757782-17757804 CTGTTGTCCTTGGGGTTCAGTGG + Intergenic
1201817201 Y:18148205-18148227 CTGTTGTCCTTGGGGTTCAGTGG - Intergenic