ID: 1113948771

View in Genome Browser
Species Human (GRCh38)
Location 13:114059691-114059713
Sequence ATGTGCTTGTCTCACTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 172}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113948771_1113948779 12 Left 1113948771 13:114059691-114059713 CCTGCACAGTGAGACAAGCACAT 0: 1
1: 0
2: 0
3: 16
4: 172
Right 1113948779 13:114059726-114059748 CACACACCAGGACCAAACAACGG 0: 1
1: 0
2: 1
3: 22
4: 337
1113948771_1113948781 14 Left 1113948771 13:114059691-114059713 CCTGCACAGTGAGACAAGCACAT 0: 1
1: 0
2: 0
3: 16
4: 172
Right 1113948781 13:114059728-114059750 CACACCAGGACCAAACAACGGGG 0: 1
1: 0
2: 0
3: 4
4: 64
1113948771_1113948780 13 Left 1113948771 13:114059691-114059713 CCTGCACAGTGAGACAAGCACAT 0: 1
1: 0
2: 0
3: 16
4: 172
Right 1113948780 13:114059727-114059749 ACACACCAGGACCAAACAACGGG 0: 1
1: 0
2: 0
3: 7
4: 145
1113948771_1113948775 0 Left 1113948771 13:114059691-114059713 CCTGCACAGTGAGACAAGCACAT 0: 1
1: 0
2: 0
3: 16
4: 172
Right 1113948775 13:114059714-114059736 GGCAGGGCCTCCCACACACCAGG 0: 1
1: 0
2: 3
3: 62
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113948771 Original CRISPR ATGTGCTTGTCTCACTGTGC AGG (reversed) Intronic
900615339 1:3563150-3563172 ATGTGTGTGACTCACTGTGAGGG - Intronic
900756892 1:4441999-4442021 TTTTTCTTGTCTTACTGTGCTGG + Intergenic
901767070 1:11508711-11508733 ATGTGCTTACCTCACATTGCAGG - Intronic
906008166 1:42496949-42496971 ATGTGGCTGGCTCTCTGTGCAGG - Intronic
906336073 1:44932263-44932285 TTTTTCTTGTCTTACTGTGCTGG - Intronic
909258363 1:73453717-73453739 GTGTATTTGTCTCACTGTTCTGG - Intergenic
910832404 1:91474019-91474041 ATGTCCTTGTCTCTGTGTACTGG - Intergenic
910872097 1:91843442-91843464 ATGTATTTTTCTCACAGTGCTGG - Intronic
915249259 1:154576841-154576863 CTGTGCTTGTCTCACCGTGTGGG - Exonic
915722500 1:157994806-157994828 ATGTGTCTGTCTCAGTGTGGGGG - Intronic
917023791 1:170619299-170619321 ATAAGCTTGTCTCATTGTGACGG - Intergenic
918014226 1:180617500-180617522 AAGTGATTGTCTCACAGTTCTGG + Intergenic
919702374 1:200643908-200643930 ATGTGCTTGTGGAACTGTGGGGG + Intronic
921134452 1:212247656-212247678 ATGTGGTTGTGTCTGTGTGCTGG + Intergenic
921932415 1:220765461-220765483 ATGTGCCTGGCACACTGTACAGG - Intronic
921936946 1:220804304-220804326 ATGTGTTGGTTTAACTGTGCTGG - Intronic
923147552 1:231208863-231208885 ATGTGTTTGTGTCTCTGAGCCGG + Intronic
1064940729 10:20732557-20732579 ATGTGCTTTTCTTACTAAGCAGG - Intergenic
1068341373 10:55708451-55708473 CAGTGCTTCTCTGACTGTGCTGG - Intergenic
1069397307 10:68003611-68003633 ATGTGACTGTCTTTCTGTGCTGG + Intronic
1070192715 10:74127279-74127301 ATGTTCTTGTACCACTGTGCTGG + Intronic
1071457805 10:85864155-85864177 AGCTGCTTGTCTAACTTTGCCGG - Intronic
1071934094 10:90507399-90507421 ATGTCTTTGTCTCAGTGTGCAGG - Intergenic
1074890710 10:117734899-117734921 ATGTTCTGGTGTCACCGTGCGGG + Intergenic
1075674059 10:124283591-124283613 ATGCGCTTGTCTGACTGCCCAGG + Intergenic
1077522099 11:3042607-3042629 ATGTGCTGGGCACGCTGTGCAGG - Intronic
1077912843 11:6587800-6587822 CTGTGCTTGGCTCACTCTACTGG - Intronic
1078797442 11:14606952-14606974 ACCTGCTGGTCTCCCTGTGCAGG + Intronic
1080898657 11:36467108-36467130 AAGTGCTGGTCTCAGTGTTCAGG + Intergenic
1081966360 11:47172526-47172548 AGGTTCCTGTCTCACTCTGCTGG - Intronic
1082825320 11:57573436-57573458 ATGTGCACATCTCACTTTGCAGG - Intergenic
1086981316 11:93200763-93200785 ATCTGCTTGTGTGTCTGTGCAGG + Intergenic
1088825885 11:113494061-113494083 CTGTACTTGTCTCTCGGTGCTGG - Intergenic
1089651839 11:119919722-119919744 TTGTGCTTGTGGCACTATGCGGG + Intergenic
1090583279 11:128182941-128182963 ATATGCTTGACTCAGTGTGCTGG - Intergenic
1091445698 12:543260-543282 CGGTGCTCCTCTCACTGTGCGGG - Intronic
1097957922 12:65505669-65505691 AAGTGCTTGTCTCGCTGTCTGGG - Intergenic
1098144360 12:67483854-67483876 CTGTGCTTGGGGCACTGTGCAGG + Intergenic
1099065232 12:77968799-77968821 ATGTGCTTGTATCAGTGTGATGG + Intronic
1100681326 12:96925603-96925625 ATTTTCTTGTCTCTTTGTGCAGG + Intronic
1102746474 12:115253330-115253352 ATCTGCCTGTTTCACTGTGTGGG + Intergenic
1105005092 12:132716639-132716661 TTGTCCTTGTGTCCCTGTGCAGG + Intronic
1108395274 13:49985454-49985476 AAGTTCTAGTATCACTGTGCTGG - Intergenic
1111869907 13:93818565-93818587 ATGGGCTTGTCCCACGATGCGGG - Intronic
1112440607 13:99422139-99422161 ATCTGCTTAGCTCCCTGTGCTGG + Intergenic
1112952965 13:105024238-105024260 ATGTGCTTTTCTAATTGTGAGGG + Intergenic
1113948771 13:114059691-114059713 ATGTGCTTGTCTCACTGTGCAGG - Intronic
1114687226 14:24544730-24544752 ATGTGCTTATTTCACATTGCAGG - Intergenic
1115870649 14:37798596-37798618 TTATTCTTGTCTAACTGTGCTGG + Intronic
1118805950 14:69237061-69237083 ATGACTTTGTCTCACTTTGCAGG - Intronic
1119106252 14:71927333-71927355 ATGTGTTTATATCACAGTGCTGG - Intergenic
1120267949 14:82275228-82275250 ATCTGTTTGTCTCACTTTTCTGG - Intergenic
1123971304 15:25510379-25510401 ATGTGCTTTTCACATTGGGCAGG + Intergenic
1124663377 15:31569394-31569416 AAGTGCTTGTTTCACTGAGCAGG - Intronic
1128027941 15:64454573-64454595 AACTGCTTTTCTCACTGTGAAGG + Intronic
1128751280 15:70151808-70151830 ATGTATTTGGCTCACAGTGCTGG - Intergenic
1128950046 15:71869721-71869743 CTGTAATTGTCTCACTGTCCTGG - Intronic
1129176985 15:73847339-73847361 ATGTGCTTGTATCACTCTTTGGG + Intergenic
1135274212 16:21097330-21097352 ATGTGGTGATCTCACTCTGCTGG - Intronic
1141231610 16:82172310-82172332 TTGTGATTTTCTCACAGTGCTGG - Intergenic
1141709820 16:85691669-85691691 GTGTGTCTGTGTCACTGTGCTGG - Intronic
1142483472 17:232441-232463 ATTTGCCTGTCTGTCTGTGCAGG - Intronic
1144529883 17:16027002-16027024 ATGTGTTTCTCACAGTGTGCTGG + Intronic
1145849294 17:28075953-28075975 ATGTGCTTTTTTCACTGTATGGG - Intronic
1147387620 17:40091397-40091419 ATGTGCCTGTCCCACCCTGCTGG + Intronic
1154047352 18:10918686-10918708 ATGTGCTGGTCTTAGTGTGTGGG - Intronic
1154173956 18:12070406-12070428 ATGTGCTGGTCTTAGTGTGTGGG + Intergenic
1158658577 18:59363570-59363592 ATGTTCTTGATTAACTGTGCAGG - Intergenic
1159875825 18:73809731-73809753 ATGTTCTTATCTGACTGTGGAGG + Intergenic
1160975577 19:1790672-1790694 AGGTGCGTGTCTCACTGGACGGG - Intronic
1161694351 19:5757759-5757781 GTGTGCTGGGCTCACTGTGGGGG + Intronic
1164966855 19:32492349-32492371 TTGTGTTTGTGTCTCTGTGCGGG + Intergenic
1166394156 19:42426587-42426609 GTTTGCTTGTCTGACTGTTCAGG + Exonic
1168407433 19:56118272-56118294 TTGTGCTTCTCCCACTATGCTGG + Intronic
926710515 2:15875803-15875825 ATGTGCTTAGCTCACTGAGATGG - Intergenic
926812161 2:16764762-16764784 ATGTCCTTGTGTCTCTGTGCAGG - Intergenic
927183583 2:20466561-20466583 CTGTTCCTGTCTCACTCTGCAGG + Intergenic
927716515 2:25356546-25356568 AGGTGCTTGGATCACTGGGCTGG + Intergenic
929375149 2:41277059-41277081 ATGTGATTGTTTCACTGTGTGGG - Intergenic
930489179 2:52046093-52046115 ATGTACTTGTCTCAATGAGAAGG + Intergenic
930835295 2:55786491-55786513 ATTTGCTTGTCTCTTTCTGCTGG + Intergenic
933726163 2:85428690-85428712 ATGTCATTTTCTCACTGTTCTGG - Intronic
937347742 2:121137125-121137147 AGGTGCTGGGGTCACTGTGCTGG - Intergenic
937599942 2:123719319-123719341 ATGTGCATGACTGACTGTGGAGG + Intergenic
939016151 2:136905717-136905739 ATGTACTTGTCTCAAATTGCTGG - Intronic
939266600 2:139881859-139881881 ATGTGCCTGGCACACTGTGATGG + Intergenic
940273806 2:151918557-151918579 ATGTGCTTGTGTAACAGTGGAGG - Intronic
942584906 2:177465481-177465503 CTGTGCTTGGCTCACGCTGCTGG + Intronic
944374274 2:199022947-199022969 AAGTGGTTGCCTCACTGTGATGG + Intergenic
945019395 2:205556093-205556115 ATGTGCTCGCCTCACTCTCCTGG - Intronic
945811581 2:214556020-214556042 ATGTGCTCATCTGAGTGTGCTGG - Intronic
947100689 2:226618166-226618188 CTGTGCTTGTGTGAGTGTGCTGG - Intergenic
947329137 2:229009884-229009906 ATGTGCCTGTTTCCATGTGCTGG - Intronic
948619867 2:239227569-239227591 AGGTGCTTGTCTGTCTGTCCAGG - Intronic
1171203801 20:23263889-23263911 AAGTTCTTCTCTCGCTGTGCTGG + Intergenic
1173569088 20:44065448-44065470 TGGTGCTTGTCTCACTGGCCAGG + Intronic
1175986932 20:62768656-62768678 ATGGGCTTCTGTCTCTGTGCTGG - Intergenic
1176036004 20:63036949-63036971 ATGTTCTTGCCTCACTGCCCTGG + Intergenic
1177104083 21:16932913-16932935 ATGTGTTTCTTTCACTGTGTTGG + Intergenic
1177354577 21:19991698-19991720 ATTTTCTTGTCTTATTGTGCTGG + Intergenic
1181019159 22:20089647-20089669 ATGTTCTTGTCTTCCTGTGCAGG + Exonic
1182084810 22:27554314-27554336 GTGTGCTTGTCTCTCTGTCTAGG - Intergenic
1183193219 22:36335266-36335288 ACCTGCTGGTCTCTCTGTGCTGG - Intronic
1183304377 22:37074463-37074485 GTGGGGTTCTCTCACTGTGCCGG - Intronic
1184256052 22:43287631-43287653 GTGTGCTTTTCTCCCTGTTCAGG + Intronic
1184639511 22:45861924-45861946 ATGGGCTTCTTTCACTGTCCAGG - Intergenic
949203120 3:1404768-1404790 GTGTGCTTGACACACTGTTCAGG - Intergenic
949894435 3:8758770-8758792 GTGTGCTGGACTCACTGGGCTGG + Intronic
952167460 3:30766331-30766353 AGGAGCTTGTGTGACTGTGCTGG - Intronic
952863042 3:37830732-37830754 GTGTGCTAGTCACACTGAGCAGG + Intergenic
954334554 3:49908769-49908791 ATGTGCCTGTGTCCCTGTGCAGG + Intronic
955163662 3:56489715-56489737 ATAAGCTTCTATCACTGTGCAGG - Intergenic
955252471 3:57298069-57298091 ATTTGCTGGTCTCTTTGTGCTGG + Intronic
955570270 3:60297630-60297652 CTTTCCTTGGCTCACTGTGCTGG + Intronic
955817540 3:62861371-62861393 ATGTACTTGTCACAATGTGTGGG - Intronic
956287344 3:67624839-67624861 ATGAGCCTGTCACACTGTCCAGG + Intronic
957124612 3:76142864-76142886 ATGTGCTTATTTCACATTGCAGG + Intronic
957618642 3:82566869-82566891 GAGTTCTTGTCTCACTGTCCTGG - Intergenic
957955255 3:87178155-87178177 CTGAGCTTTTCTTACTGTGCAGG - Intergenic
962927993 3:140012688-140012710 ATTTGCCTGCCTCACTGTGGAGG - Intronic
964506892 3:157409473-157409495 TAGTGCTTGTGTCACTGTGGAGG - Intronic
965274212 3:166659817-166659839 ATGTGCTTATTTCACATTGCAGG + Intergenic
965302613 3:167021056-167021078 AGGTGCTTTTCTCTCTTTGCTGG + Intergenic
965657755 3:171006985-171007007 ATTGGCTTTTCTCTCTGTGCTGG + Intronic
967123959 3:186408088-186408110 AGGTGCTTGTCTCCCAGTCCAGG + Intergenic
967292742 3:187937038-187937060 CTTTGCTTGTTTCACAGTGCTGG - Intergenic
969722793 4:8901979-8902001 ATTTGATTGTCTCACAGTTCAGG - Intergenic
970191925 4:13525501-13525523 ATGTGCTTGGTGCACAGTGCTGG - Intergenic
971799224 4:31266856-31266878 AAGTTCTTCTCTCACTGTGTTGG + Intergenic
972509058 4:39750668-39750690 ACGTGCTTGATTCACTGTGCTGG + Intronic
976961633 4:90983082-90983104 ATGTGTTTGAGTCTCTGTGCTGG - Intronic
980887200 4:138776029-138776051 AGGTGACTGTCTCTCTGTGCTGG + Intergenic
981678558 4:147367436-147367458 ATGAGCATCTCTCACTGTCCTGG - Intergenic
984813477 4:183816911-183816933 ATGTCTTTGTCTAACTGTACGGG + Intergenic
986713256 5:10503024-10503046 AGGTGATTTTCTCACTGTCCTGG + Intergenic
987026354 5:13930542-13930564 ATGTGCTTTTCTCACTGCCCAGG + Intronic
987748711 5:22010799-22010821 ATGTGCCTATCCCACTCTGCCGG + Intronic
990139453 5:52686179-52686201 ATTTGCTTCTCTTACTCTGCTGG - Intergenic
991101275 5:62796077-62796099 ATGTGCTTTTTCCCCTGTGCTGG + Intergenic
997158935 5:131586929-131586951 GTGTGCTTCTCCCAGTGTGCAGG - Intronic
998047827 5:139003749-139003771 ATGGGCTTCTCTTACTGTTCTGG - Intronic
999363806 5:151008095-151008117 TTGTATTTGTCTCACTGGGCTGG + Intergenic
1004327960 6:14694122-14694144 CCGTGCTTGTCTGTCTGTGCTGG - Intergenic
1005350427 6:24929376-24929398 ATGTGCTTGGCTGACTATGAGGG - Intronic
1005403286 6:25457866-25457888 TTGTGCTTTTCTCACATTGCAGG + Intronic
1006592210 6:35166676-35166698 GTCTGATTGTCTCTCTGTGCAGG + Intergenic
1010134275 6:72532186-72532208 TTGTTCTTGTCTCACTGTCTGGG + Intergenic
1010144775 6:72655406-72655428 ATTTGGATGTCTCACTGTGATGG - Intronic
1012763995 6:103340885-103340907 ATGTGTTTGTCTTACTGCTCTGG - Intergenic
1014044323 6:116866888-116866910 ATCTGCTTGTCCCAGTGTGCTGG + Intergenic
1016390543 6:143570376-143570398 TTCGGCTTCTCTCACTGTGCTGG + Intronic
1017482876 6:154874708-154874730 ATGTGCTCTTTTTACTGTGCTGG + Intronic
1018233640 6:161701180-161701202 CTGTACTTGGCTCACTGTGCAGG + Intronic
1019073381 6:169367812-169367834 ATGTGTTTTCCTCACAGTGCTGG - Intergenic
1019356898 7:584946-584968 ATGTGCTTGAGTCTCTGTGTTGG - Intronic
1020214159 7:6176713-6176735 ATGTTCTTGTCTAACTGTCCTGG + Intronic
1021565141 7:22009452-22009474 ATGTGCTTGTCTGGGTGTGGTGG - Intergenic
1023104726 7:36752450-36752472 ATCTATTTGTCTCACTGTTCTGG + Intergenic
1023294043 7:38696871-38696893 TTGTGCTTCTCCCACTATGCTGG - Intergenic
1024001818 7:45194842-45194864 GTGTGCTGGTGTCACAGTGCGGG + Intergenic
1026944203 7:74305919-74305941 GTGTGCTTGTCTGATTGTGGGGG + Intronic
1028017744 7:85736449-85736471 ATGCACTTGTCTCATTGTTCTGG - Intergenic
1028973516 7:96886606-96886628 GTGACCTTGTCTCTCTGTGCTGG - Intergenic
1029736237 7:102467482-102467504 ATGTCCCTGTCCCAATGTGCAGG + Intronic
1032550280 7:132778363-132778385 ATGTGCCTTTTTCACTCTGCTGG + Intergenic
1033372448 7:140722579-140722601 ATCTGCTCGTCTCAAGGTGCTGG + Exonic
1034244493 7:149634367-149634389 ATGTGGTTTTATCACTGAGCAGG + Intergenic
1037537798 8:19843042-19843064 ATGTGCTTTTCTAACTGTTTGGG - Intronic
1041069282 8:54111295-54111317 ATTTGCTTTTTTCTCTGTGCTGG - Intergenic
1041721741 8:60982513-60982535 ATATAATTGCCTCACTGTGCTGG + Intergenic
1042032997 8:64498150-64498172 ATGTGTATGTTTCACTGTGTTGG - Intergenic
1042054271 8:64747373-64747395 ATGTGAATTTCTGACTGTGCAGG - Intronic
1042751161 8:72159276-72159298 CTGGGCTTGGATCACTGTGCTGG + Intergenic
1046447680 8:114345076-114345098 ATGTGGTTATGTAACTGTGCTGG - Intergenic
1046700411 8:117394717-117394739 ATTTGATTTTCTCACTGTTCTGG + Intergenic
1050972877 9:11899473-11899495 ATTTTTTTGTCTCACTGTTCTGG + Intergenic
1052539348 9:29787928-29787950 ATGTGCTTATTTCACATTGCAGG + Intergenic
1052899746 9:33782179-33782201 ATGGGTTTGTCTCACTGTTGGGG - Intronic
1057315930 9:93968472-93968494 ATGTGCCTCTGTCACTGAGCGGG - Intergenic
1060018401 9:120107243-120107265 CTGTCCTTGTGTCACTGAGCAGG - Intergenic
1062618883 9:137410753-137410775 ACGTGCCTGACTCACTGTGGAGG + Intronic
1186282992 X:8014396-8014418 ATGGGCAGGTCCCACTGTGCTGG - Intergenic
1187292180 X:17965529-17965551 TTGTGGTTGTCTCACTTAGCAGG - Intergenic
1188996626 X:36894247-36894269 ATGTGCTTATTTCACATTGCAGG + Intergenic
1189240389 X:39520107-39520129 ATTTGCCTGTCTCATAGTGCCGG - Intergenic
1192403029 X:70855992-70856014 ATATGCTTGTATCACTGTATTGG - Intronic
1194492330 X:94567671-94567693 AAGTGTTTGTCTCTCTGTGCTGG + Intergenic
1199755762 X:150863640-150863662 ATCTGCCTGTATCACTGTACTGG + Intronic
1202153004 Y:21860012-21860034 AGGTCCTTGTCTCATTGTGGGGG - Intergenic