ID: 1113948911

View in Genome Browser
Species Human (GRCh38)
Location 13:114060402-114060424
Sequence CAGACCTGGCACAGTGGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 264}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113948904_1113948911 7 Left 1113948904 13:114060372-114060394 CCTGTCTCAGGTCAGCAGCCAGG 0: 1
1: 0
2: 4
3: 31
4: 278
Right 1113948911 13:114060402-114060424 CAGACCTGGCACAGTGGACCAGG 0: 1
1: 0
2: 0
3: 21
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113948911 Original CRISPR CAGACCTGGCACAGTGGACC AGG Intronic
901060463 1:6469512-6469534 CTGACCAGGAACAGGGGACCAGG + Intronic
901170628 1:7254374-7254396 CAGAACAGGCTCAGTGGACAGGG - Intronic
902262787 1:15239307-15239329 CAGGCATGGCCCAGTGCACCCGG - Intergenic
902821762 1:18947708-18947730 CAGGCCTGCTACAGTGGCCCGGG + Intronic
903354692 1:22739495-22739517 CAGGCCAGGCACAGTGGCTCAGG - Intronic
903554548 1:24184009-24184031 TAGACCAGGCACAGTGGCTCAGG - Intronic
903778739 1:25808860-25808882 CAGGCCTGGCACTGGGGTCCAGG - Intronic
905705043 1:40049490-40049512 CAGGCCTGGCGCAGTGGCTCAGG - Intronic
905806065 1:40878408-40878430 CAGGCCAGGCACAGTGGCTCAGG - Intergenic
906228963 1:44144185-44144207 CAGGCCAGGCACAGTGGGTCAGG + Intergenic
906375775 1:45295519-45295541 CAGGCCGGGCACAGTGGCTCAGG + Intronic
906696076 1:47824292-47824314 CAGACCTGCCTCTGTGGAACTGG - Intronic
907126066 1:52052295-52052317 CATATCTGCCACAGTGAACCAGG - Intronic
907563886 1:55416667-55416689 CAGGCCAGGCACAGTGGCCCAGG - Intergenic
908164670 1:61446502-61446524 AAGACCAGGAACAGTGGACAGGG + Intronic
909562971 1:77025737-77025759 ATGACCCGGCACAGTGGACGAGG - Intronic
913297550 1:117336586-117336608 CAGACATGGCAATGTGGGCCAGG + Intergenic
913508150 1:119538219-119538241 CAGACCTGCCACAGGGGATGAGG + Intergenic
915188482 1:154127834-154127856 TAGACCAGGCACAGTGGCTCAGG - Intronic
915382325 1:155453071-155453093 CAGGCCAGGCACAGTGGCTCAGG + Intronic
916399544 1:164431251-164431273 TTGGCCTGGCACAGTGGATCAGG - Intergenic
916470764 1:165120002-165120024 GAGAGCTGGCAGAGTGGAACAGG + Intergenic
918420032 1:184354806-184354828 CAGGCCAGGCACAGTGGCTCAGG - Intergenic
919777806 1:201205595-201205617 CAGCCTTGGGACAGTGGCCCAGG + Intronic
920565996 1:206973843-206973865 CAGAGCTTGGACAGTGCACCTGG - Intergenic
1062856121 10:780291-780313 CAGACCCTGCACTGTAGACCCGG - Intergenic
1062856190 10:780638-780660 CAGACCCTGCACTGTAGACCCGG - Intergenic
1062856197 10:780673-780695 CAGACCTTGCACTATAGACCTGG - Intergenic
1062856216 10:780743-780765 CAGACCCTGCACTGTAGACCTGG - Intergenic
1062856226 10:780778-780800 CAGACCCTGCACTGTAGACCTGG - Intergenic
1062856246 10:780848-780870 CAGACCCTGCACTGTAGACCTGG - Intergenic
1063433507 10:6011820-6011842 CAGGCCTGGCACGGTGGCTCAGG - Exonic
1063609966 10:7553751-7553773 CACACCTGGCACAGCGGTGCAGG - Intergenic
1063894211 10:10662159-10662181 CTGAGCTGGTACAGTGGACGTGG - Intergenic
1063971675 10:11385494-11385516 AAGGCCTGGCAAAGTGGACCAGG + Intergenic
1064729091 10:18310862-18310884 CAGTCCGGGCACAGTGGCTCAGG - Intronic
1067196021 10:44118649-44118671 CTAACCTGGCCCAGTGGACTTGG + Intergenic
1067451623 10:46385265-46385287 CTGGCCTGGCAGAGTGGACAGGG + Intronic
1067585616 10:47474491-47474513 CTGGCCTGGCAGAGTGGACAGGG - Intronic
1074116912 10:110463063-110463085 CACAGCTGGCGCAGTGGTCCAGG - Intergenic
1075572346 10:123555520-123555542 TAGAACTGGCAAAGTGCACCTGG + Intergenic
1077435768 11:2538458-2538480 CGGTCCTGGGACAGGGGACCTGG - Intronic
1077607697 11:3623096-3623118 CCCACCTCGCACTGTGGACCAGG - Intergenic
1078005223 11:7527375-7527397 CAGAACTGGCCCATTGGATCTGG + Intronic
1080571986 11:33565100-33565122 CAGACCTGGCGCAGACAACCAGG - Intronic
1080614319 11:33932868-33932890 CTGACCTGGAACTGTGGACCAGG - Intergenic
1083667428 11:64283543-64283565 CTGTCCTGGCACAGTGGCCAGGG - Intronic
1086087235 11:82967727-82967749 CAGACCTGGCACGGTGGCTCAGG + Intronic
1086190525 11:84073476-84073498 AAGACCTGCCACAGAGTACCAGG + Intronic
1086393975 11:86395333-86395355 GAGGCCTGGCACTGTGGACTCGG + Exonic
1086502859 11:87471367-87471389 CAGACCAGGCACAGTGGGGAGGG + Intergenic
1087285256 11:96258470-96258492 CTGCCCTGGCACAGAGGAGCTGG + Intronic
1087899111 11:103620892-103620914 CAGTCCTGGCAGAGTGGAGAAGG + Intergenic
1090088061 11:123668702-123668724 CAGACTTGGCAAGGTGGAACAGG + Intergenic
1090585062 11:128202435-128202457 CAGACCTGTCACAACAGACCAGG + Intergenic
1090758503 11:129815771-129815793 CAGGCCTGGCGGAGTGGAGCGGG + Intergenic
1092008431 12:5088603-5088625 CAGGCCTGGTCCTGTGGACCAGG - Intergenic
1092015873 12:5157489-5157511 CAGAGCTGGGACAGAGGTCCAGG - Intergenic
1092056891 12:5514766-5514788 CAGACCTGACAGAGTGTTCCAGG + Intronic
1094459501 12:30679114-30679136 CAGACCTGACCCACTGCACCCGG + Intronic
1099295872 12:80827104-80827126 CAGGGCTGGCACAGTGGCTCAGG + Intronic
1101944852 12:109128996-109129018 CAGGCCAGGCACAGTGGCTCAGG + Intronic
1102551092 12:113692814-113692836 CAGACCTGGCACTGGGGGCAGGG + Intergenic
1103447607 12:121004386-121004408 CAGCCCTGGAACAGTGGAGAAGG - Exonic
1104320238 12:127743812-127743834 CTGGCCTGGCACAGTGGCTCAGG + Intergenic
1104324768 12:127785657-127785679 CAGACCTGGAGCCGTGGGCCCGG - Intergenic
1107013988 13:35694649-35694671 CACACCGGTCACAGTGGACTAGG - Intergenic
1108000396 13:45900714-45900736 CAGTCATGGCTGAGTGGACCAGG + Intergenic
1108750466 13:53442816-53442838 CAGGCCAGGCACAGTGGCTCAGG - Intergenic
1110677860 13:78271246-78271268 CAGACCAGCCCCAGTGTACCTGG - Intergenic
1112128187 13:96493119-96493141 CAGACAGGGAACAGTGGATCTGG - Intronic
1112805333 13:103158683-103158705 CAGCCCTGGACCAGTGCACCAGG - Intergenic
1113948911 13:114060402-114060424 CAGACCTGGCACAGTGGACCAGG + Intronic
1114491693 14:23106286-23106308 CACACCTGGCACAGTGGGTGGGG + Intergenic
1114898263 14:27022397-27022419 CTGCCCGGGCACAGTGGCCCAGG + Intergenic
1115653525 14:35421192-35421214 CAGACCAGACACAGTGGCTCTGG + Intergenic
1116010702 14:39348112-39348134 CAGGCCAGGCACAGTGGCTCAGG - Intronic
1118723788 14:68612452-68612474 CAGAGCTGGCCCATAGGACCAGG - Intronic
1120141648 14:80936233-80936255 CAGGCCAGGCACAGTGGCTCAGG + Intronic
1120761026 14:88285391-88285413 CAGGCCAGGCACAGTGGCTCAGG - Intronic
1120833373 14:89017757-89017779 TTGACATGGCACAATGGACCTGG - Intergenic
1121121210 14:91376892-91376914 CAGACCTGGGAAAGTGGGGCTGG + Intronic
1121625884 14:95385170-95385192 CAGACCTGGGCCAGTGGAGAAGG - Intergenic
1122340196 14:101023004-101023026 CAGACCCAGCACAGTGCGCCTGG + Intergenic
1122479870 14:102040124-102040146 CAGGCCGGGCACAGTGGCTCAGG - Intronic
1124202045 15:27686926-27686948 CGCATCTGGCACACTGGACCAGG - Intergenic
1126341474 15:47645640-47645662 CAGCCCTGGCACTGTCTACCTGG + Intronic
1126621809 15:50647462-50647484 CAGGCCGGGCACAGTGGCTCAGG + Intronic
1128066302 15:64766808-64766830 CAGGCCAGGCACAGTGGCTCAGG - Intronic
1132016353 15:98320810-98320832 CACGCCTGGCACGGGGGACCTGG - Intergenic
1132633034 16:928954-928976 AAGACCTGGCAAAGTGGCCCAGG + Intronic
1132694079 16:1194419-1194441 CAGCCCTGGGACAGGGGCCCTGG + Intronic
1132936661 16:2484698-2484720 CAGCCCTGGAACAATGGAGCTGG - Intronic
1133117551 16:3586527-3586549 CAGGCCAGGCACAGTGGCTCAGG + Intronic
1136476491 16:30516955-30516977 CTCACCTGGCACAGAGGACAAGG - Exonic
1137263573 16:46850703-46850725 CAGACATAGCAAAGTGTACCAGG + Intergenic
1138499032 16:57427198-57427220 GAGTCCTGGCACAGAAGACCGGG + Intergenic
1138551945 16:57753139-57753161 CAGGACTGGCACGGTGGCCCGGG + Exonic
1138900215 16:61259854-61259876 AAGGCCTGGCACAGTGGCTCAGG - Intergenic
1138938750 16:61763210-61763232 CAGAACTGGCCCACTGGAGCTGG - Intronic
1139547461 16:67656434-67656456 CAGACCTGGCCCAGGGAGCCAGG + Exonic
1140085929 16:71796886-71796908 CAGACTGGGCACAGTGGCTCAGG + Intronic
1140877907 16:79169947-79169969 CAGAACTGGCTCTGTTGACCAGG + Intronic
1140997984 16:80279593-80279615 CAGAGCTCCCACAGTGAACCAGG - Intergenic
1141082306 16:81062962-81062984 CAGACCAGGCGCAGTGGCTCAGG + Intronic
1141148999 16:81551433-81551455 CAGACATGGCACATGGGACCTGG + Intronic
1141626824 16:85265861-85265883 CAGCCCTGTGACCGTGGACCTGG - Intergenic
1142756290 17:2018316-2018338 CAGAGATGGGACAGTGGGCCAGG - Intronic
1144015086 17:11187199-11187221 CACACTTGGCACACTGCACCAGG + Intergenic
1144194886 17:12881980-12882002 AAGGCTTGGCACAGTGGCCCAGG - Intronic
1144267096 17:13580595-13580617 CAGAACACACACAGTGGACCAGG + Intronic
1145325271 17:21817348-21817370 CAGGCCGGGCACAGTGGTTCAGG - Intergenic
1147752184 17:42743148-42743170 GAGGCCTGGCACAGTGGCTCAGG - Intronic
1147912162 17:43862198-43862220 CAGACAAGGCTCAGTGGATCTGG + Exonic
1149276281 17:55041493-55041515 CAGACCTGGGTCACTGCACCTGG + Intronic
1150358784 17:64510830-64510852 AAGGCCAGGCACAGTGGTCCAGG - Intronic
1151382805 17:73737129-73737151 CAGATCTGTCCAAGTGGACCAGG - Intergenic
1152516458 17:80827605-80827627 CACACCTGGGACAGGGGTCCTGG + Intronic
1153226164 18:2901592-2901614 CAGACCAGCCACACTGCACCAGG - Intronic
1153770225 18:8409348-8409370 CAGGCCTGGCAAAGTGCAACTGG + Intergenic
1155168122 18:23247489-23247511 CACAACTGCCACAGCGGACCAGG - Intronic
1157476176 18:48024992-48025014 GAGACCTGGCGCAGTGGCTCAGG - Intergenic
1158629044 18:59096175-59096197 TACACCTGGCACAGAGAACCAGG + Intergenic
1160298913 18:77661183-77661205 CAGGCCTAGCACAGTGGCCACGG + Intergenic
1160881940 19:1324951-1324973 CAGACCTGGGTCAGTGGCCTCGG + Intergenic
1161377433 19:3947214-3947236 CAGGCATGGGACAGTGGACCTGG - Intergenic
1161994209 19:7702552-7702574 CAAACCTGGGACATTTGACCTGG - Intergenic
1163608252 19:18287546-18287568 CAGGCCGGGCACAGTGGCTCAGG + Intergenic
1164147185 19:22519220-22519242 CAGGCTTGGCCCTGTGGACCAGG - Intronic
1164735097 19:30535462-30535484 CAGACCTGGGACAGGGCAGCTGG + Intronic
1165395451 19:35561284-35561306 GAGACATGGGACAGTGGACATGG - Intronic
1166530055 19:43537003-43537025 CAGACCAGGCAGAGTGGCTCAGG + Intergenic
1167074937 19:47242872-47242894 CAGGCCTGGCACGGTGGCTCAGG - Intergenic
1167516356 19:49925304-49925326 CAGGCCGGGCACAGTGGCTCAGG + Intronic
1167641994 19:50687191-50687213 CAGACAAGGCCGAGTGGACCTGG - Intronic
1168094996 19:54109416-54109438 CAGGCTCGGCACAGTGGCCCAGG - Intronic
1168219631 19:54951263-54951285 TAGACCAGGCACAGTGGCTCAGG + Intronic
1168671482 19:58244279-58244301 CAGACCTGGCCTGGTGGAACAGG - Intronic
925732629 2:6931102-6931124 CAGAACTGGGACAGTGTGCCCGG + Intronic
925783543 2:7406155-7406177 CATACCTAGCACCGTGGCCCAGG + Intergenic
926723987 2:15983475-15983497 CAGTCCTTGGACAGTGGTCCTGG + Intergenic
926805857 2:16710292-16710314 CAGACATGGCCCAGCAGACCTGG - Intergenic
927892213 2:26758648-26758670 CAGGCCTGACACAGGGCACCTGG + Intergenic
928050992 2:27995207-27995229 CAGAGCTGGCAAAGTGGAAATGG + Intronic
930708389 2:54526577-54526599 CACACCTGTCACAGAGGCCCAGG + Intronic
931765126 2:65448693-65448715 CAGACCTGGCTCTGTTGCCCAGG + Intergenic
933781862 2:85808016-85808038 CTGAGCTGGCACAGAGGTCCTGG + Intergenic
934575519 2:95398214-95398236 CAGACCTGGCTCTGTTGCCCAGG - Intergenic
937255880 2:120555216-120555238 CAGGCCTGGCACACTGGTGCTGG + Intergenic
937316109 2:120933071-120933093 CAGAGCTGCCACAGTGGCCCTGG + Intronic
937327036 2:120996100-120996122 CAGACCAGGCATAGTGGCACAGG + Intergenic
937887481 2:126909781-126909803 AACACCTGGCACAGTGAACATGG + Intergenic
938731267 2:134149860-134149882 GAGACCTGGAACAGTGGAGGAGG + Intronic
939592058 2:144076835-144076857 CAGGCCGGGCACAGTGGCTCAGG + Intronic
943829290 2:192438487-192438509 CAGACCTGGCAGAGTGGCAAAGG + Intergenic
946334060 2:219025873-219025895 CAGAATTGGCACAGCGGACGTGG + Intronic
946843739 2:223840932-223840954 CAGGCCGGGCACAGTGGCTCAGG + Intergenic
947675878 2:231979515-231979537 CAGGCCTGGCACAGTGGCCTTGG - Intronic
948947234 2:241226948-241226970 CATTCCTGGCACCCTGGACCCGG - Intergenic
1168802090 20:650217-650239 CAGACTTGGCAGGGTGGACAGGG + Intronic
1169130313 20:3163391-3163413 CAGACTTGGGCCAGTGGAGCTGG + Exonic
1169443085 20:5649250-5649272 CAGGCCTGGGACACTGTACCTGG + Intergenic
1170661428 20:18344159-18344181 CAGGCCAGGCACAGTGGCTCAGG - Intergenic
1170935536 20:20805921-20805943 CAGACCTGGCACATGCTACCTGG - Intergenic
1172159467 20:32856212-32856234 CAGACCAGGCACGGTGGCTCAGG - Intergenic
1172931466 20:38589267-38589289 AAGAACTGGCACAGTGGAGTGGG - Intergenic
1174143765 20:48435939-48435961 CAGGCCTCTCACAGTGGCCCAGG + Intergenic
1176059018 20:63164050-63164072 CTGACCTGGCCCAGGGGTCCTGG + Intergenic
1178123528 21:29493531-29493553 CAGCCCGGGCACAGTGGCTCAGG - Intronic
1178858803 21:36272366-36272388 CAGGCCGGGCACAGTGGCTCAGG + Intronic
1179525639 21:41974260-41974282 CTGACCTGCCCCAGGGGACCGGG - Intergenic
1179623344 21:42633018-42633040 ATGACCTGGCCCAGTGGTCCCGG - Intergenic
1180092276 21:45539271-45539293 CAGGCCTGGCAGAGTGCACGTGG + Intronic
1182496415 22:30711457-30711479 CAGGCCTGGCTCAGTGGCTCAGG + Intronic
1184067959 22:42130842-42130864 CCCACCAGGCACAGAGGACCAGG + Exonic
1184070696 22:42144515-42144537 CCCACCAGGCACAGAGGACCAGG + Intergenic
1184072578 22:42155052-42155074 CCCACCAGGCACAGAGGACCAGG + Intergenic
1184536827 22:45093316-45093338 GAGGCCAGGCACAGTGGTCCAGG - Intergenic
949719829 3:6976048-6976070 CAGAACTGGCACGGTTGGCCTGG + Intronic
949907583 3:8871622-8871644 CAGACCTTGCTCAGTGGGGCTGG + Intronic
950426206 3:12925987-12926009 CTGACCTGGCAGGGTGGTCCTGG + Intronic
950479679 3:13236702-13236724 CAGCCCTAGCACAGGGGCCCGGG - Intergenic
952001445 3:28789927-28789949 CAGACCTGTAACACTGGAACTGG + Intergenic
953931025 3:47005720-47005742 AAAACCTGGCACAGAGGACTGGG - Exonic
954121980 3:48504770-48504792 CAGCGCTGGCGCAGTGGGCCAGG + Intronic
954390495 3:50265805-50265827 ATGGCCTGGCACACTGGACCTGG + Intergenic
956208051 3:66774160-66774182 CAGACCCCACACAGTGGCCCTGG + Intergenic
959370743 3:105522161-105522183 CTGAACTGGCACAGTGGCACTGG + Intronic
961458472 3:127035902-127035924 CAGCCCTGGCACAGTGCCCACGG - Exonic
961490359 3:127253064-127253086 CAAACCAGGCAGAGTGGACCAGG - Intergenic
961816828 3:129555396-129555418 CAGACCTGGCAGAGCGCCCCTGG - Exonic
961818594 3:129563951-129563973 CAGACCTGGAGAATTGGACCAGG - Intronic
962312227 3:134334699-134334721 CAGAGCTGGCACATTGCAGCAGG + Intergenic
963920089 3:150897063-150897085 CTGACCTGTCAGAGTGGACAAGG + Intronic
964642502 3:158925104-158925126 CACACCTGGCACAGTGGCCAAGG - Intergenic
968361289 3:198148701-198148723 CAGAGCTGGCACTGTGTCCCTGG + Intergenic
968588695 4:1446880-1446902 CTGGCCTGGCACAGGGGACCCGG - Intergenic
969515303 4:7644422-7644444 CAGACATGGCCCAGTGGGGCAGG + Intronic
974651096 4:64755092-64755114 CAGTCCTGGGACAGTGCAGCAGG - Intergenic
976746120 4:88404685-88404707 CAGACCAAGCAAAGTGGCCCAGG + Intronic
977232316 4:94466247-94466269 CAGACCTGGCCCAGTGGCTCAGG - Intronic
977622155 4:99149710-99149732 CATACCTGGCAAAGGGGATCAGG - Intronic
980120598 4:128724108-128724130 CAGATCTGACACAGGTGACCTGG - Intergenic
984330257 4:178306360-178306382 CAGACCTAGCACTGTTAACCTGG + Intergenic
984425944 4:179585707-179585729 CAGAGGTGGGACAGTGGACAGGG - Intergenic
985498664 5:226348-226370 CAGGCCAGGCACAGTGGCTCAGG + Intronic
991679951 5:69129087-69129109 CAGGCCAGGCACAGTGGCCCAGG - Intronic
995975882 5:118034160-118034182 GGGACCTGGCACTGTGGAGCAGG - Intergenic
999252423 5:150190582-150190604 TAGGCCTGGCCCAGTGAACCAGG - Intronic
999753637 5:154648335-154648357 CCGGCCAGGCACAGTGGCCCAGG - Intergenic
1000021673 5:157323695-157323717 CATCCCTGGGCCAGTGGACCTGG - Intronic
1000315087 5:160082644-160082666 CAAACCAGGCACTGTGGACCAGG - Intronic
1000409398 5:160922221-160922243 CAGACCTGGCACTGAGGTCTGGG + Intergenic
1002164548 5:177336330-177336352 CAGGGCTGGCACAGAGGCCCTGG + Intronic
1002884097 6:1278567-1278589 CTGACCTGCCACAGTGGAGGAGG + Intergenic
1004441494 6:15659473-15659495 CAGAGCTATCACATTGGACCTGG - Intronic
1005975559 6:30795806-30795828 CAGACCTTCCACATTAGACCTGG + Intergenic
1006909480 6:37554879-37554901 CAGACCTGGCGCACTGGCCTGGG - Intergenic
1008610766 6:53182814-53182836 CAGGCCGGGCACAGTGGCTCAGG - Intergenic
1008807992 6:55454961-55454983 CAGGCCAGGCACAGTGGCTCAGG + Intronic
1009883231 6:69595474-69595496 CAGGTCTGTCACAGTGGACCAGG + Intergenic
1012867385 6:104634372-104634394 CAGGGCTGGCACAGTGGCTCAGG - Intergenic
1015510841 6:134036953-134036975 CAGCCCTGTTTCAGTGGACCAGG + Intronic
1016246557 6:141988445-141988467 AATACCTAGCACGGTGGACCAGG + Intergenic
1016783219 6:147983241-147983263 CAGTTCTGGCCCTGTGGACCTGG - Intergenic
1016998655 6:149979348-149979370 CAGACCTGGAAAAGTGATCCGGG + Intergenic
1017769552 6:157634632-157634654 CAGAACTGGCACTGGGGCCCGGG + Intronic
1017871275 6:158488780-158488802 CAGACCTGGGGCAGTGGAGGGGG + Intronic
1017969673 6:159301109-159301131 CAGACCTGGTACAGTGAGACCGG - Intergenic
1019110894 6:169712854-169712876 AAGACCTGGGACAGTGGTCGAGG - Intronic
1019254400 7:40020-40042 CAGAGCTGGCACTGTGTCCCTGG - Intergenic
1019667470 7:2259027-2259049 CAGGCCAGGCACAGTGCACACGG + Intronic
1020076551 7:5262579-5262601 CAGAACTGGGACAGTGGTCTTGG - Intergenic
1023735755 7:43234801-43234823 CATACCAGGCACTGTGGATCAGG - Intronic
1025150304 7:56542012-56542034 CAGCCCTGGCACAGGGCACCTGG + Intergenic
1026027092 7:66754281-66754303 AAGGCCTGGCACAGTGGCTCAGG - Intronic
1027343141 7:77231178-77231200 CAATCCTGCAACAGTGGACCTGG - Intronic
1029559886 7:101295602-101295624 CAGACCGGGCACAGTGGCTCAGG - Intergenic
1030680026 7:112424694-112424716 CAGGCCTGGCACGGTGGCTCAGG - Intronic
1031194226 7:118591493-118591515 CACAGCTTGCACAGTGCACCTGG + Intergenic
1032195939 7:129788568-129788590 CAGACCAGGCGCAGTGGCTCAGG - Intergenic
1032875946 7:136038214-136038236 CAGGCCAGGCACAGTGGCTCAGG - Intergenic
1033201841 7:139379845-139379867 CAGACCAGGCACAGTGGCTCAGG - Intronic
1033588096 7:142789023-142789045 CATACCTGTCACAGTGAGCCTGG - Intergenic
1037868650 8:22469798-22469820 CAGACAGGGCACAGTGGGGCTGG - Intronic
1037963159 8:23115015-23115037 AAGGCCTGGCCCAGTGGACAGGG + Intronic
1037967861 8:23147533-23147555 GAGGCCTGGCCCAGTGGACAGGG - Intronic
1038495802 8:28001331-28001353 CAGGCCAGGCACGGTGGTCCAGG - Intergenic
1039435512 8:37556842-37556864 CTGAGCTGCCACTGTGGACCTGG + Intergenic
1041915145 8:63131538-63131560 GAGGCCTGGCACAGTGGCTCAGG - Intergenic
1042672480 8:71280104-71280126 CAGACCTGGGACAGCAGACTTGG - Intronic
1043109891 8:76167936-76167958 TAGGCCTGGCACAGTGGCTCAGG + Intergenic
1045326658 8:101122341-101122363 CAGACCTTCCACCGTGCACCAGG - Intergenic
1045750099 8:105473199-105473221 TAGACCAGGCACAGTGGTTCAGG - Intronic
1048049803 8:130806255-130806277 CAGTCATGGCACAGAGGAGCAGG - Intronic
1048969146 8:139634656-139634678 CAGGCCTGGCCCTGGGGACCTGG - Intronic
1049106868 8:140619487-140619509 CAGACCTGGCGCCAGGGACCGGG + Intronic
1050327783 9:4514619-4514641 CAGAACTGACACAGTGGGCATGG + Intronic
1051728887 9:20117681-20117703 CAGACCTGGCACCGTTTACTAGG - Intergenic
1052436530 9:28436972-28436994 AAGACCTGGCAGAGTGAACTGGG + Intronic
1052896233 9:33750600-33750622 CAGGCCTGGCAGAGTGGAGCGGG + Exonic
1053135990 9:35650534-35650556 CACACTTGTCCCAGTGGACCAGG - Exonic
1056634926 9:88323651-88323673 CAGGCCTGGCACGGTGGCTCAGG + Intergenic
1057251416 9:93506549-93506571 CACAGCTGGCTCAGTGGATCAGG - Intronic
1057390793 9:94639970-94639992 CAGGCCAGGCAGAGTGGACGGGG - Intronic
1058589468 9:106547230-106547252 CAGGCCAGGCACAGTGGCGCAGG - Intergenic
1058884550 9:109313461-109313483 CTGACCTGGCAGAGTGGGGCTGG - Intronic
1060965173 9:127708195-127708217 CAGGCCAGGCACAGTGGCTCAGG + Intronic
1061545088 9:131299770-131299792 CAGGCCTGGCACTGTGAACGAGG - Intronic
1062146161 9:134991059-134991081 GGGACCGGGCACAGTGGAGCAGG + Intergenic
1062391156 9:136334396-136334418 CAGCCCTGGCAAAGTCGCCCCGG - Intronic
1062746000 9:138212521-138212543 CAGAGCTGGCACTGTGTCCCTGG + Intergenic
1187425117 X:19170661-19170683 CAGGCTGGGCACAGTGGAGCAGG + Intergenic
1188359144 X:29231187-29231209 CTGACCTGGCACAGTGTAGGTGG + Intronic
1192965095 X:76168953-76168975 CAGGCCAGGCACAGTGGCTCAGG - Intergenic
1193287623 X:79731658-79731680 GAGACCTGTCACAGTGTACTGGG + Intergenic
1193421788 X:81292020-81292042 CACAGCTTGCACCGTGGACCTGG - Intronic
1196194869 X:112829056-112829078 CAGACCTGGAACAGGGGGCCTGG - Intronic
1196809750 X:119619714-119619736 CAGAACTGGAACAGGGGAGCTGG + Intronic
1198432528 X:136581651-136581673 CAGAGCAGGCAGAGTGTACCTGG - Intergenic
1198520302 X:137445729-137445751 CAGACCTGGCACTGTGTGCTGGG - Intergenic
1199704622 X:150413005-150413027 CAGGCCAGGCACAGTGGTCTAGG - Intronic
1199868818 X:151877922-151877944 CAGCACAGGGACAGTGGACCTGG + Intergenic
1200205480 X:154312443-154312465 AACACCTGGCACAGAGGGCCTGG - Intronic
1201484963 Y:14484316-14484338 CTGACCAGGCACAGTGGCTCAGG - Intergenic
1201707182 Y:16950116-16950138 CATCCCTGGGACAGAGGACCTGG + Intergenic