ID: 1113950811

View in Genome Browser
Species Human (GRCh38)
Location 13:114069972-114069994
Sequence ACTTGGGGGAACCGGGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 1, 2: 0, 3: 14, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113950811 Original CRISPR ACTTGGGGGAACCGGGAAAC TGG Intronic
902570834 1:17346191-17346213 ACTTGGGGGACCCGGGCTCCTGG + Intronic
904006744 1:27366872-27366894 ACTTGGGGGATCCTGGGAATCGG + Exonic
905352006 1:37353865-37353887 ACCTGAGGGAACCGGCAAAAAGG + Intergenic
906662339 1:47592248-47592270 ACTTGGAGTCACCGGGAAGCAGG - Intergenic
907440913 1:54477635-54477657 ACTCGGGTGAACAGTGAAACAGG + Intergenic
907524917 1:55048487-55048509 ACTCGGGGGAAGCGGGAAGGGGG - Intronic
908551869 1:65216464-65216486 ACTTTGGGGAAGCGGGAGGCAGG - Intronic
909653860 1:78007867-78007889 ACTTGGGGGGAGCGGGAAGAAGG - Intronic
915781161 1:158552264-158552286 ACTTTAGGGAACCGATAAACTGG - Intergenic
918471469 1:184880179-184880201 ATTTGGGGGAACAGAGGAACTGG - Intronic
919899659 1:202034675-202034697 ACTTGGTGGAACGGGGCAGCAGG - Intergenic
1063116321 10:3074415-3074437 CCTTGGGTGAACTGGGAAGCAGG + Intronic
1064834092 10:19505679-19505701 ACTTGGAGGAATAGGGAAATTGG + Intronic
1064935642 10:20676157-20676179 CCTGGGGGAAACAGGGAAACAGG - Intergenic
1067095795 10:43298743-43298765 AGGTGGGGGAACCAGGAAAGGGG - Intergenic
1075464856 10:122643538-122643560 CCTTGGGGGAGGCGGGAACCAGG - Exonic
1076772721 10:132675443-132675465 AGTTGGGGGAAGCGGGCAAATGG + Intronic
1081779101 11:45697539-45697561 TCTTGGGAGAACTGGGAAAGAGG + Intergenic
1081973817 11:47218175-47218197 ACTTGGGGGAAACATGAAGCAGG - Intronic
1082812134 11:57484762-57484784 TCTTGGGGGGATCGGCAAACAGG - Exonic
1083142228 11:60731453-60731475 TCTTGGGGCAATCGGGAAAAGGG - Intronic
1088401000 11:109422647-109422669 AGTTGGGGGCACAGGGAAATGGG + Intronic
1088886051 11:114007973-114007995 ATTTGGGGGATCTGGGAAATGGG - Intergenic
1093233171 12:16574021-16574043 ACTTCGGGGAAGCGGGGAAGCGG - Intronic
1096992918 12:55819446-55819468 ACTTGCGGGAAGAGGTAAACTGG - Exonic
1103933165 12:124461121-124461143 ACCTGGGGGAGAAGGGAAACAGG + Intronic
1104816347 12:131648129-131648151 ACCTGGAGGAACCGGTAACCTGG + Intergenic
1110018670 13:70440865-70440887 ACTTCGGGGAAACTGGAAACTGG - Intergenic
1111311678 13:86495787-86495809 ACTTGGGAGAACAGGGGAATTGG + Intergenic
1111985937 13:95067055-95067077 ACATGGGGCAACTGGGAAACAGG + Intronic
1112774971 13:102833723-102833745 ACCTGGGAGAACCAGGAAGCTGG + Intronic
1113343852 13:109454256-109454278 GCTTGGGGGAGCCTGGGAACAGG - Intergenic
1113950811 13:114069972-114069994 ACTTGGGGGAACCGGGAAACTGG + Intronic
1113950859 13:114070085-114070107 ACTTGGGGGGACCGGGAAACTGG + Intronic
1121743055 14:96267352-96267374 ACTTGGGGGAATGGGGAGAATGG + Intronic
1125536687 15:40444764-40444786 CCATGGGGGAAACGGGAAAGAGG + Intronic
1126012366 15:44315385-44315407 ATTTGGGGGAACCTTGAAAATGG - Intronic
1128326095 15:66725274-66725296 ACTGGGGGGCATGGGGAAACGGG - Intronic
1129262863 15:74378540-74378562 ACCTGGGGGAACCGGGTGAAGGG - Intergenic
1130760720 15:86816714-86816736 ACTTGGCACAACTGGGAAACTGG + Intronic
1131075445 15:89492464-89492486 TCTTGGGGGAATTGGGGAACTGG - Intronic
1134049472 16:11126967-11126989 ACATGGGGGAACCAGGACTCGGG - Intronic
1140358423 16:74325115-74325137 ACTTGGGGGCAGCAGGAAGCAGG + Intergenic
1143757822 17:9079677-9079699 CCCAGGGGGAACCAGGAAACAGG - Intronic
1143757847 17:9079757-9079779 ACCAGGGGGAACCAGGAAACAGG - Intronic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1144489950 17:15700044-15700066 CCCTGGGGGAACCGGGCACCTGG - Exonic
1144497869 17:15760555-15760577 ACTTGGAGGAAACAGGAAACAGG - Intergenic
1144605424 17:16661102-16661124 ACTTGGAGGAAACAGGAAACAGG + Intergenic
1145161243 17:20575605-20575627 ACTTGGAGGAAACAGGAAACAGG - Intergenic
1146496809 17:33329913-33329935 ACTTGGGGCAAGAGGGGAACGGG + Intronic
1148103605 17:45107644-45107666 CCTTGGGGGAACCTGGAACTTGG + Exonic
1152300932 17:79495127-79495149 CCTCGAGGGGACCGGGAAACAGG - Intronic
1152371257 17:79890085-79890107 GCTTGGGGGAGCAGGGAGACGGG - Intergenic
1157006733 18:43591258-43591280 TCTTGGGGCAAACGGGAAAAAGG - Intergenic
1159960145 18:74549038-74549060 TCTTGGGGCAACCAGGAAAAGGG - Intronic
1161709150 19:5838130-5838152 GATTGGGGGAAACGGGGAACGGG + Intronic
1161915568 19:7225594-7225616 ACTTGGGGGACCAAGGAATCTGG - Intronic
1163364014 19:16866155-16866177 AGGTGGAGGAACCGGGAAGCCGG + Intronic
1164743929 19:30597165-30597187 AGTTGGGGGAACCTGAGAACTGG - Intronic
1165421215 19:35722870-35722892 ATTTGGGGGCACCAGGAACCTGG + Intronic
1165443811 19:35845788-35845810 AGTTGGGGGAACTGGGAGACGGG + Exonic
926989449 2:18661811-18661833 AGTTGGGGGAAGCAGGAAGCAGG + Intergenic
928952154 2:36822821-36822843 AGCTGGGGGAAGAGGGAAACAGG - Intergenic
937449383 2:121989155-121989177 GGTTGGGGGAACTGGGAAAAGGG + Intergenic
937961925 2:127466601-127466623 TCCTGGAGGAACTGGGAAACAGG - Intronic
942125229 2:172818177-172818199 ACTTGGGGGAAAGGGGAGAGAGG + Intronic
945955331 2:216081554-216081576 ACCTGGGGTAACCTGGAGACGGG - Intronic
1169496817 20:6123267-6123289 GCCTGGGGGAACAGGGAAACTGG - Exonic
1171309452 20:24134811-24134833 ACTGGGGAGAACGGGGTAACTGG + Intergenic
1172956471 20:38763176-38763198 ATCTGGGGGAACCAGGAACCAGG - Intronic
1173012009 20:39191278-39191300 ACTTGCCGGAACAGGGAACCAGG - Intergenic
1174077964 20:47951395-47951417 ACATGGGGAACCCGGGAACCCGG + Intergenic
1175996522 20:62814495-62814517 ATGTAGGGGAACCGGGAAGCGGG - Intergenic
1176200044 20:63855975-63855997 ACTTGGGGGAGCCAGGAAAAAGG + Intergenic
1176649376 21:9531086-9531108 CCATGGGGGAAGTGGGAAACAGG + Intergenic
1176851789 21:13923978-13924000 ATTTGGGGGGACTGGGTAACAGG - Intergenic
1177511310 21:22091509-22091531 AGTTGGGTGAAACGGGAAACAGG + Intergenic
1179263671 21:39782510-39782532 ACTGGGGGGAAGCGGGAATAGGG - Intronic
1180909375 22:19438166-19438188 GCTTGGGGGAAGAGGGGAACAGG - Intronic
1183065821 22:35362062-35362084 ACTTTGGGGAACAGGGAAGGAGG - Intergenic
1183129546 22:35820965-35820987 ACTTGGCAGAACCTGGCAACGGG + Intronic
1183960676 22:41410211-41410233 ACTTGGGGGCACAGGGAAGCTGG + Intergenic
1185109461 22:48893011-48893033 ACTTTGGAGAAGCGGGAAACTGG + Intergenic
949143918 3:672018-672040 ATTAGGGGGAACCGAGTAACAGG + Intergenic
950136119 3:10582197-10582219 TCTTGGGGGGACCGGGGATCTGG + Intronic
951229719 3:20163716-20163738 TCTTGGGGCAAACGGGAAAAAGG + Intronic
960598363 3:119429423-119429445 AGTTGGGTGAACTGGGATACTGG - Intergenic
964472457 3:157069739-157069761 ACTTGGGGGTAGAGGGATACAGG + Intergenic
964720851 3:159765742-159765764 ACCTGGGGGAACGGGGTAAATGG + Intronic
967459086 3:189724483-189724505 ACTTTGGGGAGCCGGGGAAAGGG - Intronic
969943360 4:10757440-10757462 ACTTGGGTGAACCTGGATACAGG + Intergenic
971545691 4:27882200-27882222 AGTTGGGAAAACAGGGAAACTGG - Intergenic
975479960 4:74866836-74866858 AATTGGGGGAATGGGGTAACAGG + Intergenic
975526165 4:75352793-75352815 TCCTTGGGGAACAGGGAAACTGG - Intergenic
975600172 4:76090911-76090933 GCCTGGGGGGACTGGGAAACAGG - Intronic
977141136 4:93373769-93373791 TCTTGGGAGAACTGGGAAAATGG + Intronic
978523195 4:109637733-109637755 ACTTTGGGGACTCGGGAAAATGG + Intronic
988719010 5:33857252-33857274 GCCTGGGGGAAGCGGGAAATGGG + Intronic
991770771 5:70038832-70038854 TCTTGGGGCAAACGGGAAATGGG + Intronic
991850065 5:70914249-70914271 TCTTGGGGCAAACGGGAAATGGG + Intronic
993499525 5:88649513-88649535 ACTTGGGGGACTCGGGGAAAGGG + Intergenic
998377821 5:141702693-141702715 GGTTGGGGGAACGGGGATACCGG - Intergenic
1000528907 5:162393694-162393716 ACTTGGGGGAATCCGGTAGCAGG - Intergenic
1001134989 5:169095114-169095136 ACTTGGCAGAAACGGGAAATAGG - Intronic
1006280514 6:33049478-33049500 ACTTGGGGGGGTCGGCAAACAGG + Intergenic
1016348343 6:143140462-143140484 AGTTGCGGGAACAGGGAAAAAGG - Intronic
1020013583 7:4818798-4818820 ACTGGTGGGAAGAGGGAAACGGG + Intronic
1021160425 7:17265734-17265756 TGTTGGGGAAACAGGGAAACTGG - Intergenic
1022995441 7:35750479-35750501 AGTTGGGGAAACAGGCAAACTGG + Intergenic
1024994496 7:55261566-55261588 ACTTGGGGGAACCTGGCATCTGG - Intergenic
1031218061 7:118923208-118923230 ACTTGGGGTAAATGGGAAAAAGG - Intergenic
1033636548 7:143217507-143217529 ACTTGGGGCAACAGGAAAAGTGG - Intergenic
1035756044 8:2033826-2033848 AACTGGGGAAACTGGGAAACTGG + Intergenic
1037212107 8:16402148-16402170 TCTTGGGGCAAACGGGAAATAGG - Intronic
1039042062 8:33417529-33417551 AAATGTGGGAACTGGGAAACAGG + Intronic
1040900918 8:52416150-52416172 ACTTGGGGAAACTGAGACACAGG + Intronic
1042311999 8:67388081-67388103 ACTTGTGGAAATTGGGAAACTGG + Intergenic
1045787908 8:105944415-105944437 CCTTGAGGGGACCAGGAAACAGG - Intergenic
1047076175 8:121406492-121406514 ACTTGGTACAGCCGGGAAACAGG + Intergenic
1048717026 8:137282086-137282108 GCTTGGGAGAACAGGGAAAAAGG - Intergenic
1049698751 8:143996970-143996992 ACTTGGGGGCAGCGGGAAGGGGG + Intronic
1059691436 9:116688709-116688731 GCTTGGGGGTACAGGGAAAAAGG - Intronic
1203627117 Un_KI270750v1:34634-34656 CCATGGGGGAAGTGGGAAACAGG + Intergenic
1189373595 X:40448990-40449012 CCCTGGGGGAACCTGGAACCAGG - Intergenic
1192902884 X:75519039-75519061 ACTTGGGGGAAGAGGGAACAGGG + Intronic
1196777905 X:119357557-119357579 ACTTGTGGGCAACAGGAAACCGG + Intergenic
1196936071 X:120732290-120732312 ATTGGGGGAAACCGGGAAAATGG + Intergenic
1201406306 Y:13653585-13653607 AATTGGTGGAACTGGGAAATAGG - Intergenic
1201771100 Y:17617768-17617790 TCTTGGGTGAACAGGCAAACAGG + Intergenic
1201830455 Y:18288218-18288240 TCTTGGGTGAACAGGCAAACAGG - Intergenic