ID: 1113950859

View in Genome Browser
Species Human (GRCh38)
Location 13:114070085-114070107
Sequence ACTTGGGGGGACCGGGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 110}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113950859 Original CRISPR ACTTGGGGGGACCGGGAAAC TGG Intronic
906662339 1:47592248-47592270 ACTTGGAGTCACCGGGAAGCAGG - Intergenic
909653860 1:78007867-78007889 ACTTGGGGGGAGCGGGAAGAAGG - Intronic
914756027 1:150562058-150562080 ATGTGGGGGGCCAGGGAAACGGG + Intergenic
923136870 1:231127702-231127724 GCTTGGGGGGCCTGGGATACAGG - Intergenic
923827557 1:237516795-237516817 ACTTGGGGGGACCTGATAATGGG - Intronic
1070987284 10:80699833-80699855 TCTCCGGGGGACTGGGAAACAGG + Intergenic
1071992149 10:91110179-91110201 ACTTGGGGTGAGCAGGAAAAAGG + Intergenic
1074764810 10:116692575-116692597 AGTTTGGGGGACCCTGAAACTGG - Intronic
1075412096 10:122235911-122235933 ACTTGGGGTGACCCTGAAGCAGG - Intronic
1076946292 10:133653348-133653370 TCTTGGGTGGACAGGCAAACAGG + Intergenic
1082812134 11:57484762-57484784 TCTTGGGGGGATCGGCAAACAGG - Exonic
1088401000 11:109422647-109422669 AGTTGGGGGCACAGGGAAATGGG + Intronic
1092109410 12:5948402-5948424 ACTGATGGGGACCTGGAAACAGG - Intergenic
1092479005 12:8843357-8843379 ACTATGTGAGACCGGGAAACGGG + Exonic
1096556693 12:52408230-52408252 ACTCGGGGGGCTCAGGAAACAGG - Intergenic
1096798937 12:54096628-54096650 GCTTTGGGGGATGGGGAAACAGG + Intergenic
1101667772 12:106835342-106835364 ACTTGTGGGGAACTGAAAACAGG - Intronic
1105266720 13:18825488-18825510 ATTTGGGGGGGCTGGGTAACAGG - Intergenic
1110018670 13:70440865-70440887 ACTTCGGGGAAACTGGAAACTGG - Intergenic
1111985937 13:95067055-95067077 ACATGGGGCAACTGGGAAACAGG + Intronic
1113950690 13:114069664-114069686 AACTGAGGGGGCCGGGAAACTGG + Intronic
1113950811 13:114069972-114069994 ACTTGGGGGAACCGGGAAACTGG + Intronic
1113950859 13:114070085-114070107 ACTTGGGGGGACCGGGAAACTGG + Intronic
1122136996 14:99639139-99639161 ACTGGTGGAGACCGGGGAACCGG + Intergenic
1202920398 14_KI270723v1_random:25974-25996 TCTTGGGTGGACAGGCAAACAGG + Intergenic
1202924532 14_KI270724v1_random:11673-11695 TCTTGGGTGGACAGGCAAACAGG - Intergenic
1128326095 15:66725274-66725296 ACTGGGGGGCATGGGGAAACGGG - Intronic
1133799105 16:9070529-9070551 CCTTGGGGTGACAAGGAAACAGG - Intergenic
1136382251 16:29901105-29901127 AGCTGGGGGGACAGGGGAACTGG + Exonic
1140184400 16:72754448-72754470 ACTTTGGGGGACTGGGAAGGAGG - Intergenic
1140358423 16:74325115-74325137 ACTTGGGGGCAGCAGGAAGCAGG + Intergenic
1142903836 17:3029443-3029465 GCTTGGGGGGATCTGGGAACCGG + Intronic
1143757847 17:9079757-9079779 ACCAGGGGGAACCAGGAAACAGG - Intronic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1144497869 17:15760555-15760577 ACTTGGAGGAAACAGGAAACAGG - Intergenic
1144605424 17:16661102-16661124 ACTTGGAGGAAACAGGAAACAGG + Intergenic
1145071147 17:19809266-19809288 CCTTGAGGGGAAGGGGAAACGGG + Intronic
1145161243 17:20575605-20575627 ACTTGGAGGAAACAGGAAACAGG - Intergenic
1147384037 17:40071414-40071436 CCATGGGGGGACAGGGACACGGG - Intronic
1151191116 17:72398828-72398850 ACTGGGGTGGACCAGGAAATGGG + Intergenic
1152300932 17:79495127-79495149 CCTCGAGGGGACCGGGAAACAGG - Intronic
1152851676 17:82640120-82640142 ACTTGGCAGGAACGGGAAGCTGG - Intronic
1160003688 18:75052452-75052474 ACATGGGAGGACCGGAAGACGGG - Intronic
1160883143 19:1331642-1331664 ATTTGGGGGGAACTGGAACCGGG - Intergenic
1161080319 19:2307277-2307299 AACTGGGGGGGCCGGGACACCGG + Intronic
1162546820 19:11335819-11335841 ACAGGGGTGGACTGGGAAACAGG - Intronic
1163622617 19:18369835-18369857 GCCTGGGGGGCCCGGGACACAGG - Exonic
1165421215 19:35722870-35722892 ATTTGGGGGCACCAGGAACCTGG + Intronic
1165443811 19:35845788-35845810 AGTTGGGGGAACTGGGAGACGGG + Exonic
928784210 2:34862467-34862489 AGTTTGAGGGACAGGGAAACTGG - Intergenic
928873582 2:36011076-36011098 ACTTGGGAAGACCTGGAAAAGGG - Intergenic
931990695 2:67787166-67787188 ACTTGGAGGGAGAGGGAAAGGGG + Intergenic
938937798 2:136142632-136142654 ACTTGGGAGGATCGGGGAAATGG + Intergenic
939590264 2:144055713-144055735 ACTCGAGGGGACAGGGAAATAGG - Intronic
944449585 2:199827328-199827350 ATTTCGGGGGACAGGGAGACTGG + Intronic
947958319 2:234213591-234213613 GCTTGGTGGGACCAGGAAATGGG - Intergenic
1169496817 20:6123267-6123289 GCCTGGGGGAACAGGGAAACTGG - Exonic
1170460500 20:16573152-16573174 GCTTTGGGGGAGCTGGAAACAGG + Intronic
1170564128 20:17585342-17585364 ACTAGGTGTGACTGGGAAACAGG + Intronic
1171424931 20:25043257-25043279 CCTTGGGGGGAGCAGGAAGCAGG - Intronic
1171797485 20:29577722-29577744 GCTTTGGGGGATGGGGAAACAGG - Intergenic
1171850766 20:30306439-30306461 GCTTTGGGGGATGGGGAAACAGG + Intergenic
1173749053 20:45462026-45462048 ACTTGGGGGGAAGGGGCAAGGGG - Intergenic
1176200044 20:63855975-63855997 ACTTGGGGGAGCCAGGAAAAAGG + Intergenic
1176851789 21:13923978-13924000 ATTTGGGGGGACTGGGTAACAGG - Intergenic
1177511310 21:22091509-22091531 AGTTGGGTGAAACGGGAAACAGG + Intergenic
1178880005 21:36441930-36441952 ACTTGGGCTGAGAGGGAAACAGG - Intergenic
1181531991 22:23522159-23522181 GCTTGGGGGGCCCAGGATACAGG - Intergenic
1183654084 22:39175097-39175119 ACTTGGGGGGCTAGGGAAGCAGG + Intergenic
1183960676 22:41410211-41410233 ACTTGGGGGCACAGGGAAGCTGG + Intergenic
1185109461 22:48893011-48893033 ACTTTGGAGAAGCGGGAAACTGG + Intergenic
1185297188 22:50060234-50060256 AGTTGGGGCGACTGTGAAACTGG - Exonic
950136119 3:10582197-10582219 TCTTGGGGGGACCGGGGATCTGG + Intronic
950151715 3:10692698-10692720 AGTTGGGAGGACAGGGAAGCAGG - Intronic
954040100 3:47879496-47879518 ACTTGGGGAGACTGGGTAAAAGG - Intronic
957081187 3:75637113-75637135 TCTTGGGTGGACAGGCAAACAGG - Intergenic
958481891 3:94653941-94653963 ACATGGGTGGCACGGGAAACAGG + Intergenic
958893681 3:99807123-99807145 GCTTGGGGGGAATGTGAAACTGG + Intergenic
964385604 3:156144630-156144652 ACGTGGGGGGACAGAGAAGCAGG - Intronic
964472457 3:157069739-157069761 ACTTGGGGGTAGAGGGATACAGG + Intergenic
969484917 4:7466824-7466846 ACTTGGGAGGTCCTGGAACCTGG + Intronic
969943360 4:10757440-10757462 ACTTGGGTGAACCTGGATACAGG + Intergenic
975347086 4:73304455-73304477 ACTTGAAGGGAGCGGGGAACAGG - Intergenic
975600172 4:76090911-76090933 GCCTGGGGGGACTGGGAAACAGG - Intronic
981641207 4:146945737-146945759 ACTTCGGCGGAACGGAAAACTGG - Exonic
985449706 4:190054000-190054022 TCTTGGGTGGACAGGCAAACAGG + Intergenic
987947897 5:24637188-24637210 ACTTGGGAAGACAGGGAAAGAGG - Intronic
989596273 5:43159044-43159066 ACTTGAGGGGAAGGGAAAACTGG - Intronic
991609306 5:68434338-68434360 ACCTGGGGAGGCCAGGAAACAGG + Intergenic
1006280514 6:33049478-33049500 ACTTGGGGGGGTCGGCAAACAGG + Intergenic
1011870369 6:91885589-91885611 ACTTGGGGGGCTCGGAAGACAGG + Intergenic
1012063135 6:94512229-94512251 AGTTGGGTGGCACGGGAAACAGG - Intergenic
1019595592 7:1856953-1856975 TCCTGGGGGGTCCAGGAAACAGG - Intronic
1019749547 7:2720304-2720326 ACGTGGGGAGACATGGAAACGGG - Intronic
1022189334 7:28001810-28001832 ACTGGGCGGGGGCGGGAAACTGG + Intronic
1024010238 7:45260521-45260543 ACTAGGAGGGACAGGGAAAAGGG + Intergenic
1024994496 7:55261566-55261588 ACTTGGGGGAACCTGGCATCTGG - Intergenic
1029437951 7:100573194-100573216 ACCTGGGGGGAACGGGGATCTGG + Exonic
1034679703 7:152919312-152919334 ACTTTGGGAGACCGAGAAAGTGG - Intergenic
1034748179 7:153542737-153542759 ACCTGGGGAGAAGGGGAAACAGG + Intergenic
1039981943 8:42415484-42415506 TCTTGGGGTGAGAGGGAAACAGG - Intergenic
1045161391 8:99549917-99549939 ACTTGGGAGGCCCAGGAAAGAGG - Intronic
1045501929 8:102750032-102750054 ACTAGGGAGGACTGGGAAGCAGG - Intergenic
1045787908 8:105944415-105944437 CCTTGAGGGGACCAGGAAACAGG - Intergenic
1049698751 8:143996970-143996992 ACTTGGGGGCAGCGGGAAGGGGG + Intronic
1051641355 9:19227716-19227738 ACTTTGGGTGGCCGGGAAGCAGG + Intergenic
1053788545 9:41669731-41669753 GCTTTGGGGGATGGGGAAACAGG + Intergenic
1054156594 9:61645037-61645059 GCTTTGGGGGATGGGGAAACAGG - Intergenic
1054176830 9:61881070-61881092 GCTTTGGGGGATGGGGAAACAGG + Intergenic
1054660705 9:67699736-67699758 GCTTTGGGGGATGGGGAAACAGG - Intergenic
1059641384 9:116220038-116220060 ACTTGGGGGGCGAGGGCAACAGG - Exonic
1059691436 9:116688709-116688731 GCTTGGGGGTACAGGGAAAAAGG - Intronic
1061193493 9:129095277-129095299 ATTTGGGGGGACCAGGGAAGAGG + Exonic
1185884521 X:3770563-3770585 ACTTGGGGGGAACGGGGGAAGGG - Intergenic
1187600442 X:20823518-20823540 AGTGGGGGGGACGGGGAACCGGG + Intergenic
1188679255 X:32981066-32981088 ACATGGAGGGACAGGGAAAACGG + Intronic
1190595375 X:52048109-52048131 ACCTGGAGGGAGGGGGAAACAGG - Intergenic
1190613449 X:52205964-52205986 ACCTGGAGGGAGGGGGAAACAGG + Intergenic
1195762924 X:108266272-108266294 ACTTGGTGGGATGGGGAAATAGG + Intronic
1196777905 X:119357557-119357579 ACTTGTGGGCAACAGGAAACCGG + Intergenic
1200954330 Y:8929304-8929326 AATTGGGGGGACTGGGGAATGGG + Intergenic