ID: 1113952201

View in Genome Browser
Species Human (GRCh38)
Location 13:114078189-114078211
Sequence GCCCCACAGCTGAGCGGGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 158}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113952189_1113952201 23 Left 1113952189 13:114078143-114078165 CCTCGCCGTGTGTGCCACATGCA 0: 1
1: 0
2: 0
3: 9
4: 82
Right 1113952201 13:114078189-114078211 GCCCCACAGCTGAGCGGGACGGG 0: 1
1: 0
2: 0
3: 16
4: 158
1113952188_1113952201 29 Left 1113952188 13:114078137-114078159 CCGGGGCCTCGCCGTGTGTGCCA 0: 1
1: 0
2: 0
3: 15
4: 167
Right 1113952201 13:114078189-114078211 GCCCCACAGCTGAGCGGGACGGG 0: 1
1: 0
2: 0
3: 16
4: 158
1113952193_1113952201 0 Left 1113952193 13:114078166-114078188 CCAGGACCGAGCCTCTCCCTGCA 0: 1
1: 0
2: 0
3: 24
4: 267
Right 1113952201 13:114078189-114078211 GCCCCACAGCTGAGCGGGACGGG 0: 1
1: 0
2: 0
3: 16
4: 158
1113952194_1113952201 -6 Left 1113952194 13:114078172-114078194 CCGAGCCTCTCCCTGCAGCCCCA 0: 1
1: 0
2: 18
3: 174
4: 1036
Right 1113952201 13:114078189-114078211 GCCCCACAGCTGAGCGGGACGGG 0: 1
1: 0
2: 0
3: 16
4: 158
1113952187_1113952201 30 Left 1113952187 13:114078136-114078158 CCCGGGGCCTCGCCGTGTGTGCC 0: 1
1: 0
2: 1
3: 19
4: 130
Right 1113952201 13:114078189-114078211 GCCCCACAGCTGAGCGGGACGGG 0: 1
1: 0
2: 0
3: 16
4: 158
1113952190_1113952201 18 Left 1113952190 13:114078148-114078170 CCGTGTGTGCCACATGCACCAGG 0: 1
1: 0
2: 3
3: 22
4: 204
Right 1113952201 13:114078189-114078211 GCCCCACAGCTGAGCGGGACGGG 0: 1
1: 0
2: 0
3: 16
4: 158
1113952192_1113952201 9 Left 1113952192 13:114078157-114078179 CCACATGCACCAGGACCGAGCCT 0: 1
1: 0
2: 1
3: 5
4: 138
Right 1113952201 13:114078189-114078211 GCCCCACAGCTGAGCGGGACGGG 0: 1
1: 0
2: 0
3: 16
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113952201 Original CRISPR GCCCCACAGCTGAGCGGGAC GGG Intronic
900215389 1:1478900-1478922 CCCTCACTGCTGAGCCGGACGGG + Intronic
900222650 1:1517567-1517589 CCCTCACTGCTGAGCCGGACGGG + Intronic
900675861 1:3885799-3885821 GCCTCACAGCTGTCCGGGCCAGG - Intergenic
902214043 1:14923761-14923783 TCCCCACAGCTGACCGGGAGAGG - Intronic
902391493 1:16109678-16109700 GACCCAGAGCTGAGCAGGAGAGG - Intergenic
902838474 1:19060876-19060898 GCCTCACTGCTGAGCTGGGCAGG + Intergenic
903779580 1:25812779-25812801 GCCCCTCACCTCAGCAGGACTGG - Exonic
903972243 1:27126526-27126548 GCCACAGAACTGAGCGTGACTGG - Intronic
907308148 1:53525016-53525038 TCCCCACAGCTGGGCCGGGCTGG - Intronic
909065364 1:70930176-70930198 GCAACACAGCTGTGTGGGACTGG + Intronic
912557565 1:110527248-110527270 ACCCCACAGCTGAGCTGAGCTGG - Intergenic
915364180 1:155304946-155304968 GCCCCACAGCAGAGTGGAAAAGG - Intergenic
915660833 1:157403689-157403711 GCCTCACTGCTGAGGGGGACTGG - Intergenic
922455082 1:225767999-225768021 GCCTCACAGCTGAGCGTAGCTGG + Intergenic
923092847 1:230752912-230752934 ACCCTACTGCTGAGCGGGGCAGG + Intronic
924763150 1:247007731-247007753 GGCCCCCACCTGCGCGGGACGGG + Intronic
1062926752 10:1321872-1321894 GTCCCACAGCTGATTGGGAAGGG + Intronic
1062930402 10:1348839-1348861 GCCCCAGAGCTGAGGTGGATGGG - Intronic
1063449111 10:6139739-6139761 GCACCACAGCTGAGAAGGACAGG - Intergenic
1067284803 10:44899713-44899735 GACTCACAGGTGAGAGGGACTGG + Intergenic
1067440996 10:46309212-46309234 GCCCCAGAGCTGGGCGGGCAGGG - Intronic
1069694912 10:70379643-70379665 GCCTCACAGCAGAGAGGGAAAGG + Intronic
1070752690 10:78973533-78973555 GCCCCTCCGCGGGGCGGGACTGG - Intergenic
1071369754 10:84939365-84939387 GCCCTACAACTCAGAGGGACAGG + Intergenic
1074983368 10:118637272-118637294 GGTCCACAGCTGAGCGGACCAGG - Intergenic
1077244898 11:1531964-1531986 TCCCCACTGCCGAGGGGGACGGG - Intergenic
1077870603 11:6259117-6259139 CCTCCACAGCTGGGCGGGAGTGG - Intergenic
1080641504 11:34161113-34161135 GCACCACAGCTGAGCGCTCCCGG + Intronic
1084445662 11:69202193-69202215 GCCTCACAGCTGAGCCAGTCTGG + Intergenic
1086739536 11:90350816-90350838 TCCCCACAGCTGGGCGGCAAGGG - Intergenic
1089800695 11:121024428-121024450 TCCCCACAGCTGCTCGAGACAGG - Intronic
1090206688 11:124888048-124888070 GTCACACAGCTGAGCTGGGCAGG - Intronic
1091281207 11:134382921-134382943 GCCCCACGGGTGAACGGGGCAGG - Exonic
1091857774 12:3753130-3753152 GCCCCTCAGCGGAGCTGAACGGG + Intronic
1096574954 12:52546898-52546920 GCACCACAGTCGAGGGGGACAGG + Intronic
1102042221 12:109808351-109808373 GCTCCACTGCTGACCTGGACGGG - Exonic
1102525887 12:113512186-113512208 GCCCCCCATCTGAGCGGGAAGGG - Intergenic
1103446712 12:120999619-120999641 GCCCCACAGGTGAGAGGCCCTGG + Exonic
1103487950 12:121295930-121295952 GCCCCAATGCTGAGAGGGGCTGG + Intronic
1103931642 12:124453803-124453825 TCCCCACAGCTGGGCTGGAGGGG + Intronic
1103987609 12:124778218-124778240 GCCCAACGGCTGAACGGGACAGG + Exonic
1104713223 12:130999728-130999750 TGACCACAGCTGAGCGGCACCGG - Intronic
1104905391 12:132210633-132210655 GCCCCACAGCCCAGGAGGACGGG - Intronic
1105756191 13:23466494-23466516 GCCCTGCAGCCGAGCGGGAGGGG + Intergenic
1110387530 13:74931529-74931551 GCCCTACAGCTGAGAGGTAATGG - Intergenic
1113672957 13:112187529-112187551 GCCCCAAAACTGTGCAGGACGGG - Intergenic
1113926808 13:113946365-113946387 GCCCCACCACAGAGGGGGACTGG - Intergenic
1113952201 13:114078189-114078211 GCCCCACAGCTGAGCGGGACGGG + Intronic
1114523318 14:23352303-23352325 GCCTCAAAGCTGAGGGGGCCTGG + Exonic
1118348580 14:64957715-64957737 ATCCCACAGCTGAGCTGGACTGG + Intronic
1118764003 14:68898064-68898086 GCCCCAGATCTGAGCAGGGCAGG - Intronic
1118798890 14:69171216-69171238 GTCCCACAGCAGAGTGGGATGGG - Intergenic
1119702015 14:76761912-76761934 GGCCCGCGGCTCAGCGGGACCGG - Intergenic
1121339924 14:93099147-93099169 CCCCCACAGCTGAGCAGGCCTGG - Intronic
1121743059 14:96267378-96267400 TCCCCACAGCTGCACGGGAAGGG + Intronic
1122891963 14:104736162-104736184 GCCCCACTGCTGGGAGGGCCAGG - Intronic
1123983592 15:25624686-25624708 GCCCCAGAGCCAAGCTGGACCGG - Intergenic
1124124797 15:26929544-26929566 GCCCCACAGCTCTCTGGGACTGG + Intronic
1127263910 15:57346151-57346173 GCCCCACAGGTGAGAGGGTTTGG - Intergenic
1128065540 15:64762302-64762324 TCCCCACAGCTGAGTGTGAGTGG + Intronic
1128741998 15:70090183-70090205 ACCCCAAAGCTGAGCGAGGCAGG + Intronic
1132587060 16:710199-710221 CTCCCACAGCTGAGGGGCACTGG - Intronic
1132929158 16:2449834-2449856 GTCCCACAGCTGAGTGGTCCAGG - Exonic
1132930195 16:2455138-2455160 GCCCCACAGCTGAGCCGGGTGGG + Intronic
1133034437 16:3027109-3027131 GGCCCACAGCTGACAGGGCCCGG - Intronic
1134071178 16:11260780-11260802 GCCACACAGCTGATGGGGAGGGG - Intronic
1136418327 16:30116866-30116888 GCCCCACTGCTGCTGGGGACTGG + Intronic
1136480851 16:30540765-30540787 GCACCACACCTGACCGAGACTGG - Intronic
1136598781 16:31269968-31269990 GCCACAGAGCTGAGCGGCAATGG + Intronic
1138390178 16:56664668-56664690 GCCACACAGCTGAGAAGGAAAGG - Intronic
1141447125 16:84068198-84068220 GCCCCACAGCTGGGTGAGCCTGG - Intronic
1142195209 16:88736461-88736483 GCCCCACACCTGCGCGGCAGAGG + Intronic
1142195226 16:88736522-88736544 GCCCCACACCTGCGCGGCAGAGG + Intronic
1142195243 16:88736583-88736605 GCCCCACACCTGCGCGGCAGAGG + Intronic
1142308114 16:89296936-89296958 TCCCCCCAGCTAAGAGGGACAGG - Intronic
1144759370 17:17698647-17698669 CCTCCACAGCTGAGCTGGCCTGG - Intronic
1146183230 17:30709956-30709978 GCACCGCACCTGAGCGGGAGGGG + Intergenic
1152183533 17:78840341-78840363 GCCGCAGAGCTCAGCGGGGCGGG - Intronic
1155300764 18:24426850-24426872 GCCCCTCGGCTGAGGAGGACTGG - Intronic
1160798195 19:955261-955283 CCCCCACAGGGGAGCGGAACCGG + Intronic
1161238738 19:3210363-3210385 GCCCGACAGCTGGGCAGGCCAGG - Intergenic
1161723782 19:5917213-5917235 GCCCCACAGCAGGGTGGGAAGGG + Exonic
1162351282 19:10151251-10151273 GCCCCTGAGAAGAGCGGGACTGG - Intronic
1162975561 19:14205818-14205840 GCACCGCACCTGAGCGGGAGGGG - Intronic
1163648189 19:18502130-18502152 GCCCCACAGCTCCACGGGGCAGG + Intronic
1164280266 19:23762847-23762869 GCCCTACTGCCGAGCGGGGCGGG + Intergenic
1167278141 19:48551292-48551314 GCCCCACAGCTGGGAGGCACTGG + Intergenic
1167379025 19:49128107-49128129 GCCCCAGGTCTGGGCGGGACAGG + Exonic
1167756345 19:51415808-51415830 GTCCCAGAGCTGAGGGGGCCTGG - Intronic
1168308512 19:55449691-55449713 CCTCCACAGCTGAGGGGGAAGGG + Intergenic
1168573829 19:57491778-57491800 GCCCCACAGCTGTGCAGGAAAGG + Intronic
1168575439 19:57504967-57504989 GCCCCACAGCTGTGCAGGAAAGG + Intronic
927497529 2:23560958-23560980 TCCCCAGGGCTGAGCTGGACTGG + Intronic
927858592 2:26543265-26543287 GCCGCACACCTGAGTGGGCCTGG - Intronic
928709452 2:33987805-33987827 GTCCCAAGGCTGAGCAGGACAGG + Intergenic
929775732 2:44929568-44929590 GCCCCGCGGCTCAGCGGGGCGGG - Intergenic
930013212 2:46953658-46953680 TCCACACAACTGAGCTGGACGGG - Intronic
936513559 2:113167671-113167693 AGCCCACAGCTGAGCTGGCCAGG + Intronic
937378137 2:121351989-121352011 GCCACAGAGCTGAGAAGGACCGG + Intronic
939629403 2:144515909-144515931 GCCCCAGAGCTGCGCGGCGCGGG - Intronic
940414867 2:153408030-153408052 GCTCTACATCTGAGCGGGAGTGG + Intergenic
948503906 2:238415128-238415150 GCCCCACACCTGAGCCCCACGGG - Intergenic
949077323 2:242069196-242069218 GCACCGCAGCTGAGGGGCACTGG - Intergenic
1169204444 20:3732285-3732307 GCCCAACAGCGGAGGGGGAAGGG - Intergenic
1170195009 20:13680729-13680751 GCCCAACACCTCAGCGGGACTGG + Intergenic
1173577222 20:44120294-44120316 GCCCCACAGTTGCACGTGACAGG + Intronic
1175992057 20:62794513-62794535 GCCCCACCGCGGGGCGGGGCCGG - Intergenic
1176219550 20:63963499-63963521 GCCCAACACCTGGGCGGGGCGGG - Intronic
1178629201 21:34244425-34244447 TCCCCAAAGCTGAGATGGACTGG - Intergenic
1178643555 21:34366038-34366060 GCCCCACTGCTAAGCCGGTCAGG - Intronic
1179923999 21:44522492-44522514 GCTCCACAGTTGAGAGGGAGGGG - Intronic
1180711527 22:17842480-17842502 GCCCCACCACTGAGGGGGCCTGG + Intronic
1180857617 22:19058359-19058381 GACCCACAGCAGAGCAGGAAAGG + Intronic
1180951912 22:19724270-19724292 GCCCCCCAGCAGAGCGGGCCGGG - Exonic
1183087778 22:35497484-35497506 GACCCAGAGCTGAGCCAGACTGG + Intergenic
1183184303 22:36282932-36282954 GAGCCACAGCTGAGCTAGACAGG + Intronic
1183417204 22:37689230-37689252 GCCCCACTGCTGAGCGGCTGAGG + Intronic
1184424864 22:44403417-44403439 GGCCCAGAGCTCAGAGGGACTGG + Intergenic
1185070037 22:48651197-48651219 GCCCCAGAGCTGAGCCAGAGGGG + Intronic
950113069 3:10432901-10432923 GCCCCCAAGTTGAGCTGGACTGG + Intronic
950653095 3:14419810-14419832 GCCCCATAGCTGAGGGGGTGGGG - Intronic
950683866 3:14602846-14602868 GACCCAGAGCTGAGCTGGCCCGG - Intergenic
954456627 3:50603147-50603169 GACACACAGCTGAGTGGGGCTGG - Intergenic
954593244 3:51802117-51802139 GCCCCACACCTCATCAGGACTGG - Intergenic
954852955 3:53618664-53618686 GCACAACATCTGAGCAGGACCGG - Intronic
956674961 3:71725085-71725107 GTGCCACAGCGGAGCGGGGCCGG + Intronic
964358519 3:155871168-155871190 GCCCCACAGCGGCGCGGGGGAGG - Intronic
964743044 3:159987831-159987853 GCTCCTCAGGTGAGCGGGAGAGG - Intergenic
968402546 4:311149-311171 GCACCACAGCTGAGAAGCACAGG + Intergenic
968929542 4:3571436-3571458 GCCCCACAGCTGTGGGGGTGAGG + Intergenic
975177122 4:71301069-71301091 GCTCCACAGCTGAGGAGGGCTGG + Intronic
977545781 4:98374822-98374844 AGCCCACAGCTGTGCGGGAACGG - Intronic
978324562 4:107537792-107537814 GTCCCAGAGCTGCGTGGGACTGG + Intergenic
980092283 4:128455342-128455364 GGCCCACAGCTGAGCTGTGCTGG - Intergenic
985572840 5:659229-659251 CCCCCACAGGTGAGCAGAACAGG - Intronic
986402499 5:7395081-7395103 GCCCCTCTGCTGAGCGGGGATGG - Intergenic
990591482 5:57269680-57269702 GCCCCAGAACTGGGCAGGACAGG - Intergenic
998266903 5:140673380-140673402 ACACCACAGCTGAGAGGGAAAGG + Exonic
1001554170 5:172625009-172625031 GCCCCCCAGCTGGGCTGGGCAGG + Intergenic
1002044209 5:176532970-176532992 GCTCCGCAACTGAGGGGGACTGG - Intronic
1002415661 5:179119658-179119680 GCCCCCCACCTGAGCCGGATGGG + Intronic
1002718938 5:181246480-181246502 GCCCCGGAGCGGAGCGGGAAAGG - Intronic
1006466104 6:34195914-34195936 GCCCCACTGCTGAGGAGGGCTGG + Intergenic
1007731279 6:43948924-43948946 GACCCACAGCTGAGAGGAGCAGG - Intergenic
1011622092 6:89252560-89252582 GCCCCACAGCTTAGCAGGTATGG + Intergenic
1017378649 6:153800859-153800881 ACCCCACAGCAGAGAGGGTCTGG - Intergenic
1018624097 6:165760799-165760821 GCCCCACAGCTGATGGTGTCAGG + Intronic
1018957315 6:168418837-168418859 CCAGCACAGCTGAGCGTGACAGG - Intergenic
1019397630 7:830701-830723 GCCCAACATCTGAGCAGGAGTGG + Intronic
1019631314 7:2051306-2051328 CCTCCAAAGCTGAGGGGGACTGG + Intronic
1023616594 7:42026185-42026207 TCCTCACAGGTGAGAGGGACAGG - Exonic
1024702569 7:51920619-51920641 TACCCACAGCTGATGGGGACTGG - Intergenic
1025191511 7:56899111-56899133 GGCCCACAGCAGAGCAGAACAGG - Intergenic
1025680438 7:63677823-63677845 GGCCCACAGCAGAGCAGAACAGG + Intergenic
1029668078 7:102008646-102008668 GGCCCCCAGCAGAGCAGGACAGG - Intronic
1032477537 7:132222518-132222540 GCCCCACAGCTGTGAGAGAAGGG - Intronic
1034556197 7:151851934-151851956 GCCCTCCAGCTGAGAGGGAGTGG - Intronic
1034911513 7:155002518-155002540 GCTCCTTTGCTGAGCGGGACGGG - Intronic
1034964766 7:155384210-155384232 CCCCAACAGGTGAGCAGGACTGG - Intronic
1036662013 8:10714856-10714878 GCCACACAGCTGGGTGGGCCGGG - Intergenic
1040482527 8:47839485-47839507 CCACCACAGCTGAGCGTCACAGG - Intronic
1045811964 8:106232037-106232059 GGACCACAGTTGAGCAGGACTGG - Intergenic
1049005571 8:139853434-139853456 GCCCCACAGGTGGAAGGGACTGG + Intronic
1049593350 8:143472495-143472517 TCCCCACTGCTGAGCGGGCCAGG + Intronic
1056578084 9:87870898-87870920 GGCCCACGGCTGAGTGGGGCTGG + Intergenic
1056842470 9:90009597-90009619 ACCCCACAGATGAGCTGGAACGG + Intergenic
1058893746 9:109382616-109382638 GGCCCACAGCTGAGCCTGAGAGG - Intronic
1062108581 9:134769345-134769367 GCCCCACAGCTGCGCGCGTGGGG - Intronic
1062211178 9:135365122-135365144 GCCCCACTGCTGAGGGCCACTGG - Intergenic
1062429496 9:136520771-136520793 GCCCCACACATGAGTGGGACCGG - Intronic
1062467336 9:136687061-136687083 GCCCCGGAGCGGGGCGGGACGGG + Intronic
1062507815 9:136886919-136886941 GGCCCACAGCTGAGCGTGGAGGG - Intronic
1195542368 X:106076969-106076991 ACACCTCAGCTGAGCTGGACTGG - Intergenic
1196893278 X:120310313-120310335 GCCTAACAGCTGAGGGGGACTGG + Intronic
1200064254 X:153497158-153497180 GGCCCACAGATGAGTGGGAGGGG - Intronic