ID: 1113957225

View in Genome Browser
Species Human (GRCh38)
Location 13:114105295-114105317
Sequence GTGCCATGGACCCTGCACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 226}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113957211_1113957225 29 Left 1113957211 13:114105243-114105265 CCTTGGGCTCCAGCCTCATCCCC 0: 1
1: 0
2: 9
3: 70
4: 712
Right 1113957225 13:114105295-114105317 GTGCCATGGACCCTGCACTGAGG 0: 1
1: 0
2: 4
3: 26
4: 226
1113957213_1113957225 16 Left 1113957213 13:114105256-114105278 CCTCATCCCCAGCAGCCGCCAGC 0: 1
1: 0
2: 7
3: 75
4: 634
Right 1113957225 13:114105295-114105317 GTGCCATGGACCCTGCACTGAGG 0: 1
1: 0
2: 4
3: 26
4: 226
1113957217_1113957225 1 Left 1113957217 13:114105271-114105293 CCGCCAGCCCTCTGAGATGCCAG 0: 1
1: 0
2: 2
3: 45
4: 351
Right 1113957225 13:114105295-114105317 GTGCCATGGACCCTGCACTGAGG 0: 1
1: 0
2: 4
3: 26
4: 226
1113957220_1113957225 -2 Left 1113957220 13:114105274-114105296 CCAGCCCTCTGAGATGCCAGGGT 0: 1
1: 1
2: 5
3: 216
4: 4561
Right 1113957225 13:114105295-114105317 GTGCCATGGACCCTGCACTGAGG 0: 1
1: 0
2: 4
3: 26
4: 226
1113957222_1113957225 -7 Left 1113957222 13:114105279-114105301 CCTCTGAGATGCCAGGGTGCCAT 0: 1
1: 0
2: 0
3: 15
4: 193
Right 1113957225 13:114105295-114105317 GTGCCATGGACCCTGCACTGAGG 0: 1
1: 0
2: 4
3: 26
4: 226
1113957215_1113957225 9 Left 1113957215 13:114105263-114105285 CCCAGCAGCCGCCAGCCCTCTGA 0: 1
1: 0
2: 1
3: 19
4: 234
Right 1113957225 13:114105295-114105317 GTGCCATGGACCCTGCACTGAGG 0: 1
1: 0
2: 4
3: 26
4: 226
1113957214_1113957225 10 Left 1113957214 13:114105262-114105284 CCCCAGCAGCCGCCAGCCCTCTG 0: 1
1: 1
2: 3
3: 51
4: 436
Right 1113957225 13:114105295-114105317 GTGCCATGGACCCTGCACTGAGG 0: 1
1: 0
2: 4
3: 26
4: 226
1113957210_1113957225 30 Left 1113957210 13:114105242-114105264 CCCTTGGGCTCCAGCCTCATCCC 0: 1
1: 0
2: 3
3: 42
4: 412
Right 1113957225 13:114105295-114105317 GTGCCATGGACCCTGCACTGAGG 0: 1
1: 0
2: 4
3: 26
4: 226
1113957216_1113957225 8 Left 1113957216 13:114105264-114105286 CCAGCAGCCGCCAGCCCTCTGAG 0: 1
1: 0
2: 2
3: 42
4: 356
Right 1113957225 13:114105295-114105317 GTGCCATGGACCCTGCACTGAGG 0: 1
1: 0
2: 4
3: 26
4: 226
1113957212_1113957225 20 Left 1113957212 13:114105252-114105274 CCAGCCTCATCCCCAGCAGCCGC 0: 1
1: 0
2: 6
3: 85
4: 734
Right 1113957225 13:114105295-114105317 GTGCCATGGACCCTGCACTGAGG 0: 1
1: 0
2: 4
3: 26
4: 226
1113957221_1113957225 -6 Left 1113957221 13:114105278-114105300 CCCTCTGAGATGCCAGGGTGCCA 0: 1
1: 0
2: 0
3: 29
4: 283
Right 1113957225 13:114105295-114105317 GTGCCATGGACCCTGCACTGAGG 0: 1
1: 0
2: 4
3: 26
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113957225 Original CRISPR GTGCCATGGACCCTGCACTG AGG Intronic