ID: 1113960232

View in Genome Browser
Species Human (GRCh38)
Location 13:114122116-114122138
Sequence GGCCGGCTGCGCAGCCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 257}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113960232_1113960243 17 Left 1113960232 13:114122116-114122138 CCTTCCAGGCTGCGCAGCCGGCC 0: 1
1: 0
2: 0
3: 24
4: 257
Right 1113960243 13:114122156-114122178 CCAGGCTGCTCCAGCCTTCAGGG 0: 1
1: 1
2: 1
3: 36
4: 345
1113960232_1113960245 28 Left 1113960232 13:114122116-114122138 CCTTCCAGGCTGCGCAGCCGGCC 0: 1
1: 0
2: 0
3: 24
4: 257
Right 1113960245 13:114122167-114122189 CAGCCTTCAGGGCCCCTCCGCGG 0: 1
1: 0
2: 2
3: 17
4: 274
1113960232_1113960241 16 Left 1113960232 13:114122116-114122138 CCTTCCAGGCTGCGCAGCCGGCC 0: 1
1: 0
2: 0
3: 24
4: 257
Right 1113960241 13:114122155-114122177 CCCAGGCTGCTCCAGCCTTCAGG 0: 1
1: 1
2: 4
3: 45
4: 485
1113960232_1113960238 -1 Left 1113960232 13:114122116-114122138 CCTTCCAGGCTGCGCAGCCGGCC 0: 1
1: 0
2: 0
3: 24
4: 257
Right 1113960238 13:114122138-114122160 CACGGCGGCAGAGCTTCCCCAGG 0: 1
1: 0
2: 1
3: 40
4: 525

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113960232 Original CRISPR GGCCGGCTGCGCAGCCTGGA AGG (reversed) Intronic
900356583 1:2267984-2268006 TGGCGGCTGCCCAGCCTGGGAGG - Intronic
900862179 1:5241578-5241600 GGCCAGCTGCCCTCCCTGGATGG + Intergenic
900946649 1:5834653-5834675 GGCCGGCCGTGCAGCTTTGATGG - Intergenic
902787183 1:18740224-18740246 GGCAGGCTGTGCAGCCTGTTGGG + Intronic
903940843 1:26930198-26930220 GCTCTGCTGCCCAGCCTGGATGG + Intronic
903962037 1:27063898-27063920 GCCTGGCTGCCCAGTCTGGAGGG + Intergenic
904046625 1:27613045-27613067 GGGATGCTGGGCAGCCTGGAGGG + Exonic
905042071 1:34968116-34968138 GCCTGGCTGCCCAGTCTGGAAGG - Intergenic
905151618 1:35931789-35931811 GGCTGGCTGCCCAGCCTCTACGG - Intronic
907269345 1:53281494-53281516 GGCCTCCTGCACACCCTGGAAGG - Intronic
908718481 1:67096940-67096962 GGCCAACTGAGCAGCCTTGATGG + Intronic
911172432 1:94783673-94783695 GGCTGGCTGGCCAGCCTGGCTGG - Intergenic
914047449 1:144103734-144103756 GGCTGGCTGGGTTGCCTGGATGG + Intergenic
914047486 1:144103907-144103929 GGCTGGCTGGGTTGCCTGGATGG + Intergenic
914047506 1:144103994-144104016 GGCTGGCTGGGTTGCCTGGATGG + Intergenic
914047562 1:144104221-144104243 GGCTGGCTTGGCAGGCTGGATGG + Intergenic
914047631 1:144104517-144104539 GGCTGGCTTCGCTGACTGGATGG + Intergenic
915321435 1:155058436-155058458 GGCCTGGTGAGCAGCCTGGGTGG + Exonic
916966156 1:169945035-169945057 GGCTGCCTGGGCACCCTGGATGG - Intronic
919788104 1:201272992-201273014 TGGCTCCTGCGCAGCCTGGATGG - Intergenic
921043853 1:211460215-211460237 GCCTGGCTGCCCAGTCTGGAAGG + Intergenic
922632912 1:227133185-227133207 GGCCGGCTGCCCCGTCTGGGAGG + Intronic
922721310 1:227901566-227901588 GGCCCGGTGGGCTGCCTGGAAGG - Intergenic
922958661 1:229626172-229626194 CGCCGGCGGCGCAGCGGGGAGGG - Intergenic
924433941 1:244022092-244022114 GGCCGGCGGGGCAGGCAGGATGG - Intergenic
1062760193 10:11845-11867 GGACGGCTGCGCAGCCGCCAGGG - Intergenic
1062988220 10:1789893-1789915 GGCCGGCAGCTCAGCCTTGCAGG - Intergenic
1063664843 10:8055086-8055108 GGCTGGCTGAGCAACTTGGAGGG - Intronic
1064353654 10:14599296-14599318 GGCCTGCTGAGCAGCCCAGAGGG + Intronic
1065047467 10:21757267-21757289 GGGCGGCTCTGCAGCCTGTAGGG - Intronic
1067031074 10:42879140-42879162 GGTAGGATGGGCAGCCTGGAGGG + Intergenic
1070913252 10:80136225-80136247 GGCCTGATGTGCACCCTGGATGG - Intronic
1071509166 10:86250577-86250599 GGCCAGCTGCCCAGTCTGGGAGG + Intronic
1072421108 10:95291084-95291106 GGGCGGCTACGCGGCCTGGGCGG - Intergenic
1072727837 10:97825513-97825535 GGCCGGCCCCACTGCCTGGAAGG - Intergenic
1072729010 10:97832216-97832238 GGCCGGCAGCCCAGACTGGGAGG + Intergenic
1073076281 10:100827320-100827342 GCCCGGCTGCGCACCCTCCAGGG - Intronic
1076417267 10:130300809-130300831 TGCCCGCTGTGCAGCCTGCAAGG + Intergenic
1076417422 10:130301361-130301383 TGCCCGCTGTGCAGCCTGCAAGG + Intergenic
1077539540 11:3140042-3140064 GCTCGGCTGTGCAGCCTGGGAGG + Intronic
1078141223 11:8694399-8694421 GGCGGGCTGAGCACCCTGCAGGG + Intronic
1078164532 11:8870972-8870994 GGCCGGGCGCGGCGCCTGGATGG + Intronic
1079107302 11:17579705-17579727 GGCAGGCTGTGCACCCAGGATGG - Intronic
1079479343 11:20863615-20863637 GCCCGGCTGCCCAGTCTGGGAGG - Intronic
1083999612 11:66289011-66289033 GGCCCGCTGCGCCGCCTCGTGGG + Exonic
1085201917 11:74707025-74707047 GGCAGGGTGCTCAGGCTGGAGGG - Intronic
1086434896 11:86770975-86770997 GCCCGGCTGCCCAGTCTGGGAGG - Intergenic
1089255535 11:117192160-117192182 GGCTGGCTGCTCAGCCAGGCTGG - Intronic
1090265077 11:125348535-125348557 GCCCTGCTCCGCAGCCTGGTGGG + Intronic
1093107992 12:15112334-15112356 GGAGGGCTGGGCAGCATGGAGGG + Intronic
1094103187 12:26784830-26784852 GCCTGGCTGCCCAGTCTGGAAGG + Intronic
1095962847 12:47846241-47846263 GGCCAGCTGGGCAACCTGAAGGG - Intronic
1097691567 12:62739005-62739027 GGCGGGCAGCGCATCCAGGAAGG + Intronic
1103280259 12:119752131-119752153 GGCCGCCCGTGCAGCCTGCAGGG + Exonic
1103779461 12:123389276-123389298 AGCCGCCCGCGCAGCCGGGAGGG - Intronic
1105069395 12:133225624-133225646 GACCAGCTGCCCAGTCTGGAAGG + Intronic
1105240988 13:18609610-18609632 TGCCCGCTGCGCAGGCTGGAGGG + Intergenic
1106603858 13:31209521-31209543 GGCAGCCTGCATAGCCTGGAAGG + Intronic
1107498930 13:40955394-40955416 GGCCAGCTGCCCATCCGGGAAGG + Intronic
1110219659 13:73059518-73059540 GGCCGGCTGCGGGGCCTGCGCGG - Exonic
1111337109 13:86838956-86838978 GGCCAGCTGGGCTTCCTGGATGG + Intergenic
1113368416 13:109700257-109700279 GGCCAGCTGCCAAGCCAGGAGGG - Intergenic
1113960232 13:114122116-114122138 GGCCGGCTGCGCAGCCTGGAAGG - Intronic
1115320704 14:32076976-32076998 GCGCGGCGGCGCAGCCTGGACGG - Intronic
1118887598 14:69879652-69879674 TGCCGGCTGCCCAGCCTGGCTGG + Exonic
1119666972 14:76491721-76491743 GGGCGGCGGCGGGGCCTGGAAGG + Intronic
1121623917 14:95371148-95371170 GGCAGGCAGGGCAGCCTGGACGG - Intergenic
1121658979 14:95620600-95620622 GGCCAGCTGCCTAACCTGGATGG + Intergenic
1122629847 14:103102632-103102654 GGCCGGCTTCCCAGCGTGGGAGG + Exonic
1122857646 14:104567504-104567526 AGCCGGCTGTGCAGCAGGGAGGG + Intronic
1123035589 14:105470627-105470649 GGCCGGCCGAGCTGCCTGGCGGG + Exonic
1123417368 15:20103379-20103401 GGCCGGCTGGGCTGGCTGGCTGG + Intergenic
1123490369 15:20775535-20775557 TGCCCGCTGCGCAGGCTGGAGGG - Intergenic
1123526643 15:21110233-21110255 GGCCGGCTGGGCTGGCTGGCTGG + Intergenic
1123546870 15:21344622-21344644 TGCCCGCTGCGCAGGCTGGAGGG - Intergenic
1123707968 15:22964423-22964445 AGCAGACTCCGCAGCCTGGAAGG + Intronic
1125745167 15:41992798-41992820 CTCCGGCAGCGCAGCCAGGAAGG - Exonic
1127734041 15:61825308-61825330 GCACTGCTGGGCAGCCTGGAGGG + Intergenic
1128582871 15:68821024-68821046 GGCGGGCTGCGCAGCCGGCCAGG + Intronic
1128687212 15:69695659-69695681 GGCCGTCGGGGCAACCTGGATGG - Intergenic
1129111918 15:73342092-73342114 GGCAGGCAGGCCAGCCTGGAGGG - Intronic
1202955201 15_KI270727v1_random:71838-71860 TGCCTGCTGCGCAGGCTGGAGGG - Intergenic
1132544707 16:527880-527902 CGCCGGCCGCGCTGCCCGGACGG - Exonic
1132747470 16:1443009-1443031 GGCGGGCTGAGCAGCCTCGGCGG + Intronic
1133232769 16:4374295-4374317 GGCCGGCGGCCCAGCGCGGAGGG - Intronic
1134644806 16:15857484-15857506 GGCCGGCTGTGCAGCGTGAAGGG + Intergenic
1136559457 16:31030481-31030503 GGCCCTCTGAGCAGCCTTGACGG - Intergenic
1136716108 16:32285607-32285629 GGCTGGCTGGGCTGCCTGGGTGG + Intergenic
1136716137 16:32285719-32285741 GGCTGGCTGGGCTGCCTGGGTGG + Intergenic
1136716160 16:32285813-32285835 GGCCGGCTGCGTGGCTTGGGTGG + Intergenic
1136716198 16:32285984-32286006 GGCCGGCTTGGCTGCCTGGCTGG + Intergenic
1136834525 16:33492010-33492032 GGCTGGCTGGGCTGCCTGGGTGG + Intergenic
1136834533 16:33492044-33492066 GGCCGGCTTCGCTGGCTGGTTGG + Intergenic
1136834586 16:33492275-33492297 GGCCGGCTTGGCTGCCTGGCTGG + Intergenic
1139472252 16:67184508-67184530 CGGCGGCAGCGCAGCCTGCAGGG + Exonic
1139885629 16:70205172-70205194 GGCCAGCTGCCCAGTCTGGGAGG + Intergenic
1203010216 16_KI270728v1_random:231757-231779 GGCCGGCTTGGCTGCCTGGCTGG - Intergenic
1203010276 16_KI270728v1_random:232022-232044 GGCTGGCTGGGCTGCCTGGGTGG - Intergenic
1203010439 16_KI270728v1_random:232708-232730 GGCCGGCTTGGCTGCCTGGCTGG - Intergenic
1203010466 16_KI270728v1_random:232830-232852 GGCTGGCTGGGCTGCCTGGGTGG - Intergenic
1203138501 16_KI270728v1_random:1745579-1745601 GGCTGGCTTGGCTGCCTGGATGG - Intergenic
1142810492 17:2393574-2393596 GGCCCGCGCCGCAGCGTGGACGG + Intronic
1143067797 17:4263687-4263709 GGCCGGCTGCGGAGCCGGGCTGG - Exonic
1144327119 17:14193203-14193225 AGCCGGCGGCGCTGCCTGGATGG + Intronic
1144476006 17:15590066-15590088 AGCCGGCGGCGCTGCCTGGATGG + Intronic
1145018072 17:19411753-19411775 GCCCGGCAGCCCAGCCGGGAGGG + Intronic
1145250015 17:21292141-21292163 AGCAGGCTGCTCAGGCTGGAGGG - Intronic
1145920329 17:28604762-28604784 GCCTGGCTGCCCAGTCTGGAAGG - Intronic
1147935263 17:44007264-44007286 GGCCGTTTGCGCAGCCTGGTGGG - Intronic
1148334470 17:46832285-46832307 GGCCGGCTGAGCTGCCCGGAGGG + Intronic
1148341634 17:46876768-46876790 GGCCGGCTGGGCAGCTTGAAGGG - Exonic
1148765740 17:50037356-50037378 GCCCGGCTGCCCAGCTTGGGAGG + Intergenic
1150382112 17:64729043-64729065 GGTCCGCAGCTCAGCCTGGAGGG - Intergenic
1150774158 17:68065808-68065830 GGTCCGCAGCTCAGCCTGGAGGG + Intergenic
1151473125 17:74330241-74330263 TGCCAGCTGTGCAGCCTGGGGGG + Intronic
1152026326 17:77811801-77811823 TGCCGGCTCAGCACCCTGGAGGG - Intergenic
1152650690 17:81491301-81491323 GGGAGGCTGCCCACCCTGGATGG - Intergenic
1152953101 18:12199-12221 GGACGGCTGCGCAGCCGCCAGGG - Intergenic
1154192687 18:12243549-12243571 GCCCGGCTGCCCAGTCTGGGAGG + Intergenic
1154420355 18:14223349-14223371 GCCAGGCTGCCCCGCCTGGAAGG + Intergenic
1154447976 18:14450292-14450314 TGCCCGCTGCGCAGGCTGGAGGG - Intergenic
1155648990 18:28117358-28117380 GGCCAGGTGGCCAGCCTGGAAGG - Intronic
1155654268 18:28176856-28176878 GCCGGGCTGCGCACCCGGGAAGG - Intronic
1156018720 18:32575776-32575798 GGCTGGCAGCACAGCCTGCAAGG - Intergenic
1159880027 18:73850270-73850292 GGCAGGTTGAGCAGGCTGGAGGG - Intergenic
1160668574 19:344870-344892 GGCAGGGGGCGGAGCCTGGAGGG + Intergenic
1160917269 19:1503300-1503322 GGCCGGTTGCGCAGCCCCTAGGG + Intergenic
1160979995 19:1812352-1812374 GGCCGGGGGCGGGGCCTGGAGGG + Intergenic
1161242228 19:3228771-3228793 GGCGGGCTGGGCGGCCTGGCGGG + Intronic
1161685704 19:5701819-5701841 GCCTGGCTGCCCAGTCTGGAAGG + Intronic
1161849527 19:6731355-6731377 TGCGGGCTGGGGAGCCTGGATGG + Intronic
1162112158 19:8405095-8405117 GACTGGCTGCCCTGCCTGGAGGG + Intronic
1162130174 19:8521562-8521584 GGCCGGCTTCACGGCCAGGAGGG - Exonic
1163546855 19:17945787-17945809 GGAGGGCTGGGCAGGCTGGAAGG + Intergenic
1164460796 19:28445877-28445899 GGATGGCTGCCCTGCCTGGAAGG + Intergenic
1164619712 19:29687353-29687375 GGCCAGAGGCGCAGCCAGGAGGG + Intergenic
1164648216 19:29874092-29874114 GGCTGGCTGCGGGTCCTGGAGGG + Intergenic
1164977193 19:32581783-32581805 GGCCGCCTGGGAAGCTTGGATGG + Intronic
1167915924 19:52740048-52740070 GTGCTGCTGGGCAGCCTGGATGG - Intergenic
1168649057 19:58081439-58081461 GGCCTGCTGGTCAGCATGGAGGG + Intronic
1202687063 1_KI270712v1_random:57410-57432 GGCTGGCTTCGCTGACTGGATGG + Intergenic
1202687190 1_KI270712v1_random:57978-58000 GGCTGGCTGGGTTGCCTGGATGG + Intergenic
1202687418 1_KI270712v1_random:58919-58941 GGCTGGCTGGGTTGCCTGGATGG + Intergenic
1202687432 1_KI270712v1_random:58980-59002 GGCTGGCTGGGTTGCCTGGATGG + Intergenic
1202687452 1_KI270712v1_random:59067-59089 GGCTGGCTGGGTTGCCTGGATGG + Intergenic
925394737 2:3525159-3525181 GGCCGGGTGCCCAGTCTGGGAGG + Intergenic
925730635 2:6917662-6917684 GGCCGGCCGCGGAGCGGGGAGGG + Intronic
926199120 2:10780684-10780706 GGGCAGATGCGCATCCTGGAAGG - Intronic
927948248 2:27150193-27150215 GGCAGGCAGAGCAGCCTGCAAGG - Exonic
929172465 2:38945551-38945573 GGCCTGCAGCGCAGCTGGGAGGG - Intronic
929808524 2:45169410-45169432 GGCCGGGCGCGCGGACTGGAGGG + Intergenic
933958998 2:87396946-87396968 GGCTGGCTTCGCTGCCTGGCTGG - Intergenic
933959094 2:87397380-87397402 GGCTGGCTTCGCTGCCTGGCTGG - Intergenic
933959196 2:87397826-87397848 GGCTGGCTTCGCTGCCTGGCTGG - Intergenic
933959495 2:87399083-87399105 GGCCGGCTTGGCAGGCTGGCTGG - Intergenic
933964810 2:87425189-87425211 GGCCGGCTTGGCTGGCTGGATGG - Intergenic
933965746 2:87429398-87429420 GGCTGGCTTCGCTGCCTGGCTGG - Intergenic
933965751 2:87429424-87429446 GGCTGGCTTCGCTGCCTGGCTGG - Intergenic
933977013 2:87519804-87519826 GGCAGGCTGCCCAGCCTGCAGGG - Intergenic
934243920 2:90292517-90292539 GGCTGGCTTCGCTGCCTGGCTGG - Intergenic
934244061 2:90293127-90293149 GGCCGGCTTGGCAGGCTGGCTGG - Intergenic
934264789 2:91504304-91504326 GGCCGGCTTGGCAGGCTGGCTGG + Intergenic
934270032 2:91527671-91527693 GGCCGGCTTCGCTGACTTGATGG + Intergenic
935137572 2:100321489-100321511 TGCCGGCTGCGCAGGCTGGCAGG - Exonic
935783546 2:106529277-106529299 GGCTGGCTCTCCAGCCTGGATGG + Intergenic
936316804 2:111431001-111431023 GGCAGGCTGCCCAGCCTGCAGGG + Intergenic
937886440 2:126902557-126902579 AGCTGGCAGCTCAGCCTGGAAGG + Intergenic
938320416 2:130358875-130358897 GGCCTGCTCGGCCGCCTGGAAGG + Exonic
941603141 2:167563968-167563990 GGCCGGCTGCCCCGTCCGGAAGG - Intergenic
942951167 2:181723601-181723623 GGCTGGCTGGGCTGGCTGGAGGG + Intergenic
947869719 2:233427911-233427933 GGCAGGGTGAGCAGCCAGGAAGG + Intronic
948426023 2:237886980-237887002 TCCCGTCTGCACAGCCTGGATGG - Intronic
948980850 2:241494029-241494051 GGCCAGCAGCTCAGCCGGGAGGG + Exonic
1169198733 20:3697397-3697419 GTCCAGCCGCCCAGCCTGGAAGG + Intronic
1169224289 20:3846732-3846754 AGGCGGCTGCGCAGCGGGGACGG - Intergenic
1170900055 20:20453734-20453756 GGCCCGGTGCCCACCCTGGAGGG - Intronic
1172735755 20:37125708-37125730 GCCTGGCTGCCCAGTCTGGAAGG + Intronic
1173729206 20:45316973-45316995 CCCCGGCTGCCCACCCTGGAGGG + Exonic
1174803151 20:53581921-53581943 AGCCAGCTGCCAAGCCTGGAAGG + Exonic
1175198954 20:57265441-57265463 GGCCGGCGGCGTAACATGGAGGG + Intronic
1175816590 20:61886240-61886262 GGCCGGCTGCACAGCCAGTGAGG - Intronic
1176193252 20:63824135-63824157 GGCCGGCTGCTCAACCTCGAAGG - Intronic
1176448248 21:6840403-6840425 TGCCCGCTGCTCAGGCTGGAGGG + Intergenic
1176826418 21:13705425-13705447 TGCCCGCTGCTCAGGCTGGAGGG + Intergenic
1179340539 21:40504287-40504309 GGCCGACTCCTCAGCCAGGAGGG + Intronic
1179456943 21:41506926-41506948 GAAGGGCTGCGCAGCCTCGAAGG + Intronic
1179708265 21:43194848-43194870 GGCCGGCTGGGGCCCCTGGACGG - Intergenic
1179991655 21:44951349-44951371 GGCTTGCTGCACAGCCTGGGAGG + Intronic
1180553878 22:16560807-16560829 GGCTGGCTTGGCAGGCTGGATGG - Intergenic
1180554251 22:16562777-16562799 GGCTGGCTTCGCAGGCTGGCTGG - Intergenic
1180554912 22:16565649-16565671 GGCTGGCTTGGCAGGCTGGATGG - Intergenic
1180554988 22:16565960-16565982 GGCTGGCTTGGCAGGCTGGATGG - Intergenic
1180555351 22:16567523-16567545 GGCTGGCTTGGCAGGCTGGATGG - Intergenic
1180555395 22:16567696-16567718 GGCTGGCTTGGCAGGCTGGATGG - Intergenic
1180555485 22:16568076-16568098 GGCTGGCTTGGCAGTCTGGATGG - Intergenic
1180840885 22:18958336-18958358 CGGCGGCTGCGCAAGCTGGAAGG - Intergenic
1180955797 22:19740702-19740724 GGCCCGCTGGGCAGGCGGGAGGG - Intergenic
1181060605 22:20280438-20280460 CGGCGGCTGCGCAAGCTGGAAGG + Intronic
1183185710 22:36290635-36290657 GCCTGGCTGCCCAGTCTGGAAGG + Intronic
1183279145 22:36922899-36922921 GACCGACTGTGCAGCCTGGGAGG - Intronic
1183299527 22:37052027-37052049 GGCCGGGTCCCCAGCCTGGCGGG - Intronic
1183333684 22:37234763-37234785 GGAGGGCTGGGCAGCCTGGAGGG - Intronic
1183491943 22:38121546-38121568 GGCCGGCTGCACCTCCAGGAAGG + Intronic
1184106270 22:42369079-42369101 AAGCGGCTGCGCAGCCCGGACGG - Intergenic
1184178015 22:42800779-42800801 GGCTGCCTGGGCAGGCTGGAGGG + Intronic
1184409605 22:44318928-44318950 GGCCAGCGCCGCATCCTGGAGGG - Intergenic
1184783913 22:46662689-46662711 GGTGGGCCGAGCAGCCTGGATGG + Intronic
1185048964 22:48543815-48543837 GCCCGGATGCCCCGCCTGGAGGG - Intronic
1185181417 22:49365631-49365653 GCCCAGCGGTGCAGCCTGGAGGG + Intergenic
950028766 3:9838145-9838167 GGGCAGCTGGGCAGCCTGGGAGG + Exonic
954059895 3:48058299-48058321 GGCCGGCTGGCCAGCCTGCGAGG + Intronic
958959122 3:100492394-100492416 CGGCGGCTGCGCGGCCGGGACGG - Intergenic
961643597 3:128380563-128380585 GGCCTCCTGAGCAGCCTGGAGGG + Intronic
961780843 3:129319272-129319294 GGCCGGCTCCTCAGCCTGTGAGG + Intergenic
962411217 3:135143282-135143304 GCCCGCCTGTGCAGCCTGGTGGG + Intronic
963602807 3:147392267-147392289 GCCTGGCTCCGCAGCCCGGAGGG + Intronic
964482944 3:157160263-157160285 GGGCGGAGGCGCGGCCTGGAGGG - Intronic
964628017 3:158777648-158777670 GGCCTGCTACGCAGACAGGATGG + Intronic
970409172 4:15790664-15790686 GCCTGGCTGCCCAGTCTGGAGGG + Intronic
971067611 4:23051479-23051501 GGTCAGGTGCGCATCCTGGAAGG - Intergenic
973317815 4:48779981-48780003 CGCCGGCAGCCCAGCCTGGGCGG - Intronic
992391746 5:76336400-76336422 GCCTGGCTGCCCAGTCTGGAGGG - Intronic
992891440 5:81207896-81207918 GGCAGGCAGCGCAGAGTGGAGGG + Intronic
998119042 5:139561343-139561365 GGCGGGCTGCGCCGCCGGGGTGG - Exonic
1000049962 5:157554372-157554394 GGCTGCCTGTGCAGCCAGGAAGG - Intronic
1002180088 5:177426804-177426826 GGCCGGCGGCGCGGCCCGGCGGG + Intronic
1002521831 5:179796551-179796573 CGCGGGCTACGGAGCCTGGAGGG + Intronic
1002566303 5:180114223-180114245 GCCGTGCGGCGCAGCCTGGATGG + Intronic
1002927172 6:1611283-1611305 GCGCGGCCGCTCAGCCTGGACGG + Exonic
1003319527 6:5038393-5038415 GCCTGGCTGCCCAGTCTGGAAGG - Intergenic
1005973592 6:30780233-30780255 GGCTAGCTGCCCTGCCTGGAAGG - Intergenic
1006988629 6:38194146-38194168 GGCCGGCAGGGGAGCCTGCAAGG + Intronic
1008888989 6:56463598-56463620 GGCCGCCTGCGCAGCCTGACTGG + Exonic
1017249814 6:152267823-152267845 GATAGGCTGCGCAGGCTGGAAGG + Intronic
1018170343 6:161139215-161139237 GACCCCCTCCGCAGCCTGGACGG - Intronic
1019635379 7:2072807-2072829 GGATGGCTGGGCAGCCTTGAAGG + Intronic
1019711464 7:2519979-2520001 CGCGCGCTGCGCAGCCTGGCGGG + Exonic
1022149539 7:27586964-27586986 GGCACGTTGCGCAGCATGGACGG - Intronic
1024048515 7:45601462-45601484 GGCCTGCTGTCCACCCTGGAAGG + Intronic
1025021164 7:55481258-55481280 AGCCCGCTGGGCAGCCAGGAGGG + Intronic
1030602685 7:111609798-111609820 GCCTGGCTGCCCAGTCTGGAGGG + Intergenic
1033185885 7:139226349-139226371 GCCCGGCTGCCCCGCCTGGGAGG + Intergenic
1034196228 7:149250312-149250334 GCCCGGCTACAGAGCCTGGAGGG + Exonic
1034275119 7:149820651-149820673 GGCCGGCTGCCCAGCAGGCATGG + Intergenic
1034983691 7:155494644-155494666 GGCCTGCTGTGGAGCCTGGGCGG + Intronic
1035259612 7:157653109-157653131 GGCCGGCTGCACCGTCTGGGGGG - Intronic
1035475031 7:159137139-159137161 GGCCGGCCGCCCACCCTGAATGG + Intronic
1036195186 8:6708173-6708195 GGCCGGCTGCGGACGCGGGAAGG - Intergenic
1036560750 8:9898760-9898782 GACCGGCTGCACGGCCGGGAGGG + Intergenic
1037502183 8:19496908-19496930 CGCCGGCTGCACAGCATGGTCGG - Intronic
1041931835 8:63295545-63295567 GGCCGGCAGCACAGTCTGCAGGG - Intergenic
1045298763 8:100893026-100893048 GCCTGGCTGCCCAGTCTGGAAGG - Intergenic
1047202986 8:122781973-122781995 GGCCGGCGGCGCCGGCTGGGGGG - Intronic
1049707571 8:144049987-144050009 GCGAGGCTGGGCAGCCTGGACGG + Intergenic
1049709725 8:144058054-144058076 GTCCAGCTGCGGGGCCTGGAGGG + Exonic
1049752459 8:144291656-144291678 GGGCGGCGGCGCGGCCCGGAAGG + Exonic
1050362919 9:4847803-4847825 GGCCAGGTGACCAGCCTGGAAGG - Intronic
1051350587 9:16194841-16194863 AGCCGGCTGTGCTGCCTTGAAGG + Intergenic
1053081714 9:35183306-35183328 GCCCGGCTGCCCCGCCTGGGAGG - Intronic
1053550926 9:39078741-39078763 GGCCCGCTGCGCAGCGGGGGCGG - Exonic
1055336136 9:75235386-75235408 GGCCGGCTGTGAAGGCTGGAAGG - Intergenic
1057751436 9:97796372-97796394 GTCCGGCTGCCCAGTCTGGAAGG + Intergenic
1058058781 9:100474015-100474037 GGCCGGCCGCTCAGCCTCGCCGG - Intronic
1058705881 9:107637670-107637692 GGCAGGCAGCGCAGCCTGCGGGG - Intergenic
1059406059 9:114098771-114098793 GGAGGGCTGGGCATCCTGGAAGG + Intronic
1061043070 9:128150806-128150828 GAGCTGCTGAGCAGCCTGGAGGG + Intronic
1062443334 9:136583269-136583291 AGCCGGCTAGCCAGCCTGGAGGG - Intergenic
1062566227 9:137165092-137165114 GGGCCGCTGCCCAGCCTGGCCGG - Intronic
1062581936 9:137232589-137232611 GGCAGGCTGCGCCGCGTGGCCGG + Exonic
1062689740 9:137835049-137835071 AGCCGGCGGCGCAGCCCCGAAGG - Exonic
1203520943 Un_GL000213v1:44115-44137 TGCCCGCTGCTCAGGCTGGAGGG - Intergenic
1185761019 X:2690420-2690442 CGCGGGGTGCGCAGCCGGGAGGG - Intergenic
1187449144 X:19381524-19381546 GTCCTGCTGCGAAGGCTGGAGGG + Intronic
1187844538 X:23523005-23523027 GCCCGGCTGCCCCGCCTGGGAGG + Intergenic
1192663862 X:73068883-73068905 GCCCGGCTGCCCCGCCTGGGAGG + Intergenic
1192664109 X:73069658-73069680 GCCCGGCTGCCCCGTCTGGAAGG + Intergenic
1192969972 X:76218728-76218750 GCCTGGCTGCCCAGTCTGGAAGG - Intergenic
1193729641 X:85087238-85087260 TGCCGTCTGCTCATCCTGGAAGG + Intronic
1195410959 X:104567359-104567381 CGCGGGCTCTGCAGCCTGGAAGG + Intronic
1195964418 X:110417221-110417243 TGGCGGCTGCTCAGCTTGGAGGG + Intronic
1197820180 X:130534146-130534168 GGCTGGCTGCCTTGCCTGGAAGG + Intergenic
1198233940 X:134718634-134718656 GGCCTGCAGCCCCGCCTGGAGGG + Intronic