ID: 1113960916

View in Genome Browser
Species Human (GRCh38)
Location 13:114125758-114125780
Sequence CTGTGTTCACGCAGGAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113960916_1113960919 -3 Left 1113960916 13:114125758-114125780 CCTCCTTTCCTGCGTGAACACAG 0: 1
1: 0
2: 2
3: 8
4: 167
Right 1113960919 13:114125778-114125800 CAGACCCCTGCTCTGACCCGCGG 0: 1
1: 0
2: 2
3: 49
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113960916 Original CRISPR CTGTGTTCACGCAGGAAAGG AGG (reversed) Intronic
905042666 1:34973182-34973204 CTGCGTTGACTCAGGGAAGGAGG - Intergenic
905809854 1:40904240-40904262 GTGTGTTCCAGCAGGAATGGAGG - Intergenic
905887722 1:41500669-41500691 GTTTGCTCACCCAGGAAAGGAGG - Intergenic
907372636 1:54013324-54013346 CTGTGTTCCTGCAGGGCAGGGGG + Intronic
908912182 1:69084835-69084857 CTGTCTTCAGGCAGAAAAGGAGG - Intergenic
909477122 1:76093643-76093665 CTGTCTTCAGGCAGAAAATGGGG - Intronic
910551995 1:88486046-88486068 CTGTGTCCACCCAGGCAATGTGG + Intergenic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
914841038 1:151249005-151249027 CTGTCTTCATGCAGGGAAGTTGG + Intronic
914920051 1:151840202-151840224 CTGTGTTTATCCAGGAAAAGAGG - Exonic
915873570 1:159587972-159587994 CTTTGCTCACACAGGTAAGGAGG + Exonic
917109366 1:171529401-171529423 CTGTGGGTATGCAGGAAAGGTGG - Intronic
918096550 1:181341020-181341042 CTGAGATCACACAGGTAAGGAGG + Intergenic
920535149 1:206732316-206732338 CAGTGATCCCGCAGGATAGGAGG - Intronic
924798116 1:247307637-247307659 CTTTGTCCATGCATGAAAGGGGG + Intronic
1063189215 10:3678399-3678421 CTGTGTCCACACACAAAAGGAGG - Intergenic
1070419037 10:76218191-76218213 CTGTGTGCACTGAGGAAAAGAGG + Intronic
1071199941 10:83209913-83209935 CTGTCTTCAGGCAGAAAAGGGGG + Intergenic
1072362577 10:94674230-94674252 CTGTGTTCACACATAACAGGAGG - Intergenic
1072621459 10:97082152-97082174 CTGTGTTCAGGCAGGCAGCGGGG - Intronic
1073208965 10:101783142-101783164 CGCTGTTCCCGCAGGAGAGGGGG - Intronic
1073719779 10:106154876-106154898 CTGTGGTCACCCAGGAACTGGGG - Intergenic
1074165806 10:110872493-110872515 CCGGGTTCACGAAGGACAGGGGG - Intronic
1074498070 10:113997314-113997336 CTGTGTCCACTCAGCAAAGCTGG + Intergenic
1085936546 11:81152621-81152643 CTGTGTTCAAGGAGGAAAATAGG + Intergenic
1087054525 11:93920606-93920628 CTGTGTTCCCTCAGGTGAGGAGG + Intergenic
1088753408 11:112865150-112865172 CTGTGATCAGGCAGGAAGTGTGG - Intergenic
1090964403 11:131585432-131585454 CTTGGTTCCTGCAGGAAAGGAGG + Intronic
1091339495 11:134799328-134799350 CTGGGATCACCCAGGAGAGGCGG - Intergenic
1095353715 12:41245411-41245433 CTGCTTTCAAGCAGGAAAGATGG + Intronic
1095391413 12:41711288-41711310 CTGTGCTCAAACAGGAAATGAGG + Intergenic
1096311886 12:50528651-50528673 ATGAGTTCACCCAGGAAAGAGGG + Intronic
1106188881 13:27432871-27432893 CTGTGATCACGCTGAAAAGATGG + Intronic
1106498582 13:30306436-30306458 CAGTGTTCAGGCTGGCAAGGGGG + Intronic
1112161733 13:96875213-96875235 CTTTGTTCACCCATGAAAAGAGG + Intergenic
1112346658 13:98595821-98595843 CAGTGGTCAGGCAGGAATGGTGG + Intergenic
1113874009 13:113583448-113583470 CTGTATGCACGGAGGAGAGGGGG - Intergenic
1113960916 13:114125758-114125780 CTGTGTTCACGCAGGAAAGGAGG - Intronic
1115661925 14:35504274-35504296 ATGTGTGCATGCATGAAAGGTGG - Intergenic
1115860715 14:37683079-37683101 GTGTGTTCACTCTGAAAAGGGGG + Intronic
1117158325 14:52962626-52962648 CTGTCTTTAGGCAGAAAAGGAGG - Intergenic
1118564496 14:67124434-67124456 CAGTGTACAGGAAGGAAAGGGGG + Intronic
1122891728 14:104735142-104735164 CTGTGTGTGAGCAGGAAAGGGGG + Intronic
1122994687 14:105256678-105256700 CTTTGATCAGGAAGGAAAGGTGG + Intronic
1128041443 15:64577985-64578007 CTGTTTTCTTGCAGGGAAGGGGG - Intronic
1130968137 15:88712085-88712107 CTGAGTTAAGGCAGAAAAGGTGG + Intergenic
1131769289 15:95717403-95717425 CTGTCTTCAAACAAGAAAGGTGG + Intergenic
1131898216 15:97057524-97057546 CTGTGTTCATGTAGGAAAGGTGG - Intergenic
1137944205 16:52718050-52718072 CTGTGTGCGGTCAGGAAAGGAGG + Intergenic
1139559985 16:67735816-67735838 ATGGGATGACGCAGGAAAGGAGG + Intronic
1143448562 17:7022637-7022659 CTGTGTTAAGGGAGAAAAGGGGG - Intergenic
1143522366 17:7451970-7451992 CTGCTTTCATGCAGGAGAGGGGG + Intronic
1143877794 17:10005546-10005568 CTGTGTTCATGCAGGAAGGTGGG + Intronic
1144044999 17:11447484-11447506 CTGTGTTAACTCAAGGAAGGTGG - Intronic
1144435263 17:15234220-15234242 GTGTGTTCACTCAGGCAAGTGGG + Intronic
1145398347 17:22512836-22512858 CTGTGGTCAGGCAGGCAAGTGGG + Intergenic
1146528754 17:33590110-33590132 CTGGGTTCATTCAGGAAAAGAGG + Intronic
1148137113 17:45300645-45300667 CTGTGGGCAGGCAGAAAAGGAGG - Intronic
1148837196 17:50471639-50471661 CAGTGTTGGAGCAGGAAAGGAGG - Intronic
1150421993 17:65045230-65045252 CTGTGTTCAGCCAGGCATGGCGG + Intronic
1151988724 17:77560354-77560376 GTGTTTTAACGGAGGAAAGGTGG - Intergenic
1153028739 18:693681-693703 CTGTGCTCATGCAGGCAGGGTGG - Intronic
1155443976 18:25891459-25891481 CTGTCTTCACAGAGAAAAGGAGG + Intergenic
1156572885 18:38279179-38279201 CTTTGTTTCCACAGGAAAGGAGG - Intergenic
1156856197 18:41784020-41784042 CTGAGTTCATGCTGGAAATGGGG - Intergenic
1157757522 18:50231927-50231949 CTGTGTTGGCCCAGGAGAGGGGG - Intronic
1162689229 19:12414903-12414925 CAGTGTGCAAGCAGGATAGGAGG - Intronic
1164899246 19:31904305-31904327 CTGTGATCCAGCAGGAAAAGAGG + Intergenic
1165244024 19:34487647-34487669 CTTTGTTGACTGAGGAAAGGCGG + Intronic
1167695382 19:51012593-51012615 ATGTGTTCACACAGCAACGGGGG + Intergenic
925352557 2:3211720-3211742 TTCTGTTCACGCAGGAGAGCAGG - Intronic
925387564 2:3472818-3472840 CTGACTTCACGGAGGACAGGTGG + Intronic
926590572 2:14735819-14735841 CTGTGCTGACGCTGGGAAGGTGG - Intergenic
927213897 2:20655309-20655331 CTGTGTTCCCGCAGCATAGAGGG + Intergenic
927948274 2:27150324-27150346 CGGAGTCCACGCAGGAAGGGCGG - Exonic
928109613 2:28495969-28495991 CTGTGTTCACCTTTGAAAGGGGG - Intronic
931195877 2:60052059-60052081 CTGTCTTCACTCAGGCAATGGGG - Intergenic
933979156 2:87536564-87536586 CTGTGTTCTCCCAGGGAGGGGGG - Intergenic
936314671 2:111414228-111414250 CTGTGTTCTCCCAGGGAGGGGGG + Intergenic
938337165 2:130510430-130510452 CTGTGTCCACGCCGGCAAGAGGG + Intergenic
938352672 2:130610301-130610323 CTGTGTCCACGCCGGCAAGAGGG - Intergenic
942464478 2:176193038-176193060 CTGTGTTTATACAGGAAAAGAGG + Intergenic
946367854 2:219261295-219261317 CTGTCTTAAGGCAGGAAATGGGG + Intronic
946892043 2:224286827-224286849 CTGTGCTGAGGCAGTAAAGGCGG + Intergenic
947204310 2:227646187-227646209 CTCTTTTCAGGCAGGCAAGGTGG - Intergenic
948304353 2:236935636-236935658 CTGTGTTCTCAGAGGAAATGGGG - Intergenic
948627877 2:239280287-239280309 CTGTGTTAAAGAAGGAAAGAAGG + Intronic
1168963013 20:1881636-1881658 CTGTGTCCCAGCAGGAAAGGTGG - Intergenic
1171346860 20:24471553-24471575 CCGTTTTCAGGCAGGAAATGGGG - Intronic
1172873579 20:38150739-38150761 CTGAGGTCACACAGCAAAGGCGG - Intronic
1173648116 20:44646211-44646233 CTGTGTTCACACAGGGAGGCAGG - Intronic
1175681018 20:60988953-60988975 ATGTGTCCAAGCAGGACAGGGGG + Intergenic
1179389604 21:40975698-40975720 CTGTGTTCTCACTGGAAAGCTGG + Intergenic
1179612653 21:42562681-42562703 CTGTGTTCACACATGACATGGGG - Intronic
1180005130 21:45017248-45017270 GTGTGTGCACGCAGGGAACGTGG - Intergenic
1180102465 21:45595232-45595254 CTGTGGTCACCCAGGGAGGGAGG + Intergenic
1180120709 21:45745708-45745730 CTGTCTTCACGGAGAAAGGGAGG + Intronic
1181370852 22:22415646-22415668 CTGTGTCCTCACAGGAAAGCTGG + Intergenic
1183441775 22:37827088-37827110 CTGTGTACAAGCTGGAATGGAGG + Intergenic
1184316689 22:43698724-43698746 CTGAGTTCCCTGAGGAAAGGTGG + Intronic
1184645985 22:45895776-45895798 CTGAGGTCAGGCAGGGAAGGTGG + Intergenic
950967737 3:17157583-17157605 GTGTGTGTCCGCAGGAAAGGAGG + Intronic
951436890 3:22675912-22675934 CTGTGTTCACTCAGGATAAAAGG + Intergenic
959627446 3:108468792-108468814 CTGTTTTCAGGCAGGAACGTGGG - Intronic
959790453 3:110355135-110355157 CTGACTTCATGCAGGAAGGGAGG - Intergenic
961103317 3:124220502-124220524 TTGTGTTAACATAGGAAAGGAGG + Intronic
963831011 3:150009268-150009290 CTGTGTTTAAGCAGGAGTGGTGG - Intronic
968433333 4:572289-572311 GGGTGTGCACGCAGGGAAGGAGG + Intergenic
968909814 4:3472001-3472023 CTGCTTTCACGCAGCAAGGGTGG + Intronic
971261155 4:25057938-25057960 ATTTGTTCAGTCAGGAAAGGTGG - Intergenic
975720878 4:77247617-77247639 TTGAGTTTACTCAGGAAAGGAGG - Intronic
979188214 4:117824954-117824976 CTGTTTTCAAAGAGGAAAGGTGG + Intergenic
980499007 4:133624829-133624851 CAGTGTGCACCCAGCAAAGGGGG + Intergenic
980717357 4:136644380-136644402 CTGTTTTCAGGAAGAAAAGGGGG - Intergenic
982271073 4:153589066-153589088 ATGTGTCCCCGCAGGTAAGGAGG - Intronic
983550125 4:169009516-169009538 AGGAGTTCAGGCAGGAAAGGTGG - Intronic
985651381 5:1109280-1109302 ATGTGGTCACGGAGGAAGGGTGG + Intronic
986650889 5:9962347-9962369 ATGTGTTGAGGGAGGAAAGGAGG - Intergenic
989115015 5:37943975-37943997 GTGTGTGCACACAGGAAAAGAGG + Intergenic
990091261 5:52052700-52052722 CTGTGTTCTCACATGGAAGGAGG + Intronic
990529472 5:56659549-56659571 CTGTGTTCACCCCTGAAACGGGG + Intergenic
990890838 5:60648211-60648233 CTGTTTTGAGGCAGGAAAGAGGG - Intronic
995182879 5:109245337-109245359 CTGTTTTCCCTCAGGAAAAGAGG + Intergenic
999460850 5:151756795-151756817 CTGTGTAGACGTAGGACAGGTGG - Intronic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1002642525 5:180636981-180637003 CTGTGTGCACCCAGGAAAATGGG - Intronic
1005482454 6:26267620-26267642 ATGTGTTCAGGGAGAAAAGGAGG - Intergenic
1005532135 6:26718667-26718689 CTTTCTTCACGTAGGAAATGAGG + Intergenic
1005538660 6:26782998-26783020 CTTTCTTCACGTAGGAAATGAGG - Intergenic
1006520810 6:34570100-34570122 CTGTGGTCACGCAGGACTGCTGG - Intergenic
1007386744 6:41525110-41525132 GAGTGTTCTAGCAGGAAAGGTGG + Intergenic
1007597306 6:43059510-43059532 CGGCGTTCAGGTAGGAAAGGAGG - Exonic
1009722691 6:67494300-67494322 CTGTATTCACGTAGCAAAAGAGG - Intergenic
1013420521 6:109962589-109962611 CTGTGTTCAGAGAGGAAAGAGGG + Intergenic
1015927374 6:138323694-138323716 CTGTGTTCACTGAGGAGATGTGG + Exonic
1019594803 7:1853576-1853598 CTGTGGTCAGGCAGGCAGGGTGG - Intronic
1021402775 7:20228735-20228757 CTATGTTCACACAGAAAAGCAGG + Intergenic
1023578556 7:41656600-41656622 CTGAATTCACTCAGGAAATGTGG - Intergenic
1023674716 7:42617470-42617492 CTGTGTGCAAGCAGGAGAGAGGG - Intergenic
1024394177 7:48847289-48847311 CTGTTTTCATGCAGTAAAGAAGG - Intergenic
1024401060 7:48925125-48925147 CTGTTTTCATGCAGTAAAGAAGG + Intergenic
1024563012 7:50660320-50660342 CTGCATTCATGCAGGAAGGGAGG + Intronic
1024975021 7:55105546-55105568 CTGTTTTCATGAAGAAAAGGAGG - Intronic
1029549115 7:101227584-101227606 CTCTGTGCTCCCAGGAAAGGGGG - Intergenic
1029724790 7:102395668-102395690 CAGTGTTCAGGCAAGAGAGGTGG + Intronic
1031431602 7:121677345-121677367 CTGACTTCAAACAGGAAAGGAGG - Intergenic
1036743572 8:11388719-11388741 CTGTGTTGACTCTGGAAAGAGGG - Intergenic
1037068240 8:14610269-14610291 CTGTTTTCAGGGAGAAAAGGGGG - Intronic
1037504268 8:19515088-19515110 CTGGGTTCCCGAAGGAATGGGGG - Intronic
1037856540 8:22375156-22375178 CTGTGTTCAGACTGGAAAGGAGG - Intronic
1038248469 8:25881273-25881295 CTGTGTTCAAGCTGCAAAGGTGG - Intronic
1038251659 8:25910780-25910802 CTGGGTTCACGAAGGAGAAGGGG + Intronic
1038331506 8:26613160-26613182 CTGTGTTCATCCAGGAAAATGGG + Intronic
1039608161 8:38899993-38900015 CGGTGTTAACAGAGGAAAGGCGG - Intergenic
1041564629 8:59262553-59262575 ATGTGTTCACCTCGGAAAGGAGG - Intergenic
1043052874 8:75404710-75404732 CAGTTTACACGCAGGAAGGGGGG - Intergenic
1044592662 8:93929384-93929406 CAGTGTTCACGCTGGAAGGCTGG - Intergenic
1045497302 8:102719376-102719398 ATGTGGTCACGTAGGAGAGGAGG + Intergenic
1046177714 8:110600740-110600762 CTGTGTTCACTCATGGCAGGAGG + Intergenic
1046564273 8:115878663-115878685 CTGTGTTGACACAGGAAAAATGG + Intergenic
1048134011 8:131728373-131728395 CTGTGGTCAAGCAGCAAGGGAGG + Intergenic
1049139058 8:140934932-140934954 CTGTGTTTATGCAGAAAAGGAGG + Intronic
1049356613 8:142192392-142192414 CTAGGTCCACCCAGGAAAGGGGG - Intergenic
1050226164 9:3458106-3458128 CTGTTTTCATGCAGGAATGATGG + Intronic
1050750272 9:8929152-8929174 GTGTGTTCAGTTAGGAAAGGAGG - Intronic
1051735821 9:20198197-20198219 ATGAGTTCACTCGGGAAAGGGGG + Intergenic
1053139619 9:35674434-35674456 CTCTGTTCACTCAGGGAAGGAGG + Intronic
1054360553 9:64110755-64110777 CTGTGTTCAGGCAGTGAATGGGG + Intergenic
1056303237 9:85263645-85263667 CTATGATCAAGCAGGGAAGGTGG + Intergenic
1057610793 9:96541825-96541847 CTGTTTTCATGCAGTAAAGAAGG - Exonic
1059232290 9:112732114-112732136 CTGTGTTCTTGAAAGAAAGGCGG + Intergenic
1060533535 9:124364243-124364265 CTGTGTACAAGCAGGAGAGTCGG + Intronic
1062541791 9:137044803-137044825 GTGTGCTCAGCCAGGAAAGGCGG - Intronic
1193963027 X:87948589-87948611 CTGTGTTTGTTCAGGAAAGGGGG - Intergenic
1194995421 X:100586781-100586803 CTGTGTTCAGGCTGGCAGGGTGG + Intronic
1195367143 X:104137453-104137475 GTTTGTTCACACATGAAAGGAGG - Intronic
1195420043 X:104664500-104664522 CTGTGATCTCGGAGAAAAGGAGG - Intronic
1199614060 X:149641192-149641214 CTGTGTTCAGGAAGGAAAGGAGG + Intergenic