ID: 1113961526

View in Genome Browser
Species Human (GRCh38)
Location 13:114128820-114128842
Sequence CAGGCCCGGCCTCCCACGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 178}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113961512_1113961526 15 Left 1113961512 13:114128782-114128804 CCAGAGAGCCACAGGAAGCCCCA 0: 1
1: 0
2: 3
3: 33
4: 384
Right 1113961526 13:114128820-114128842 CAGGCCCGGCCTCCCACGGACGG 0: 1
1: 0
2: 1
3: 19
4: 178
1113961516_1113961526 7 Left 1113961516 13:114128790-114128812 CCACAGGAAGCCCCAGCGGGGAG 0: 1
1: 0
2: 4
3: 38
4: 297
Right 1113961526 13:114128820-114128842 CAGGCCCGGCCTCCCACGGACGG 0: 1
1: 0
2: 1
3: 19
4: 178
1113961519_1113961526 -4 Left 1113961519 13:114128801-114128823 CCCAGCGGGGAGCCCACGGCAGG 0: 1
1: 0
2: 1
3: 9
4: 204
Right 1113961526 13:114128820-114128842 CAGGCCCGGCCTCCCACGGACGG 0: 1
1: 0
2: 1
3: 19
4: 178
1113961518_1113961526 -3 Left 1113961518 13:114128800-114128822 CCCCAGCGGGGAGCCCACGGCAG 0: 1
1: 0
2: 3
3: 18
4: 237
Right 1113961526 13:114128820-114128842 CAGGCCCGGCCTCCCACGGACGG 0: 1
1: 0
2: 1
3: 19
4: 178
1113961521_1113961526 -5 Left 1113961521 13:114128802-114128824 CCAGCGGGGAGCCCACGGCAGGC 0: 1
1: 0
2: 0
3: 16
4: 207
Right 1113961526 13:114128820-114128842 CAGGCCCGGCCTCCCACGGACGG 0: 1
1: 0
2: 1
3: 19
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113961526 Original CRISPR CAGGCCCGGCCTCCCACGGA CGG Intronic