ID: 1113962213

View in Genome Browser
Species Human (GRCh38)
Location 13:114132404-114132426
Sequence GTCGGACGCGTGGCTGCCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 47}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113962213 Original CRISPR GTCGGACGCGTGGCTGCCGG CGG Intronic