ID: 1113962213

View in Genome Browser
Species Human (GRCh38)
Location 13:114132404-114132426
Sequence GTCGGACGCGTGGCTGCCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 47}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113962213 Original CRISPR GTCGGACGCGTGGCTGCCGG CGG Intronic
904609060 1:31715217-31715239 GCTGGAGGCGTGGCTGTCGGCGG - Intergenic
1073215924 10:101836160-101836182 GTTGGACGCGTGCCCCCCGGTGG - Intronic
1077268780 11:1665559-1665581 GCAGGTAGCGTGGCTGCCGGAGG + Intergenic
1085069955 11:73534980-73535002 GTTGGAGGCCTGGCTGCCTGTGG - Intronic
1090056177 11:123426986-123427008 GTCAGAGGCCTGGCTGCAGGTGG + Intergenic
1101967595 12:109291918-109291940 GCCGGAGGGGTGGCAGCCGGGGG - Intronic
1101967603 12:109291933-109291955 GCCGGAGGGGTGGCGGCCGGAGG - Intronic
1101967610 12:109291948-109291970 GCCGGAGGGGTGGCAGCCGGAGG - Intronic
1108676022 13:52738931-52738953 GAGGGGCGCGCGGCTGCCGGCGG - Intronic
1113962213 13:114132404-114132426 GTCGGACGCGTGGCTGCCGGCGG + Intronic
1114187440 14:20413460-20413482 GTGGGAAGGGTGGCAGCCGGGGG + Intergenic
1122542890 14:102507862-102507884 GTGGGACGCGCGGCGGCCTGGGG - Exonic
1122597916 14:102905906-102905928 GGCGGACGCGTGCCGGCGGGAGG + Exonic
1123987571 15:25658777-25658799 GGCGGACGCGGGGGAGCCGGGGG + Intergenic
1124038909 15:26082365-26082387 GTCGGAGGCGTGGCAGAAGGCGG - Intergenic
1128111304 15:65077793-65077815 GACCGACGCGTGGCTGCCAGTGG + Exonic
1136958007 16:34806223-34806245 TTCTGCCGCGTGGCTGCTGGAGG + Intergenic
1142029818 16:87832944-87832966 GGAGGCCGAGTGGCTGCCGGAGG - Exonic
1146794787 17:35773496-35773518 GTCAGACGAGGGGCTGCTGGGGG - Intronic
1161063755 19:2227790-2227812 GTCGGCCGCGGGGCTGCATGTGG + Intronic
1161988498 19:7670532-7670554 GTGGGGCGCGTAGCTGCTGGAGG + Intergenic
1162100248 19:8334800-8334822 GGCGGACGCGTGGGTGACCGAGG - Exonic
1165995120 19:39838629-39838651 GTGGGACACGTGGGTGCCAGGGG + Intronic
1166520180 19:43475008-43475030 GTGGGACGCGTGGCTCCCAGAGG + Intronic
1166869802 19:45864347-45864369 GTCGGACGGGCGGGCGCCGGTGG + Exonic
1167075202 19:47244248-47244270 GGCGGCCCCGTGGCTTCCGGAGG + Intergenic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
934689908 2:96350598-96350620 CTTGGACGTGTGGCTGCCTGAGG + Intronic
938397851 2:130963962-130963984 GGCGGCCGCGGGGCTGCCGGGGG - Intronic
1173704612 20:45100842-45100864 GTGGGAGGCGGGGCTGCCTGGGG - Intronic
1173813892 20:45972495-45972517 GTGGGGGGCGTGGCTCCCGGTGG + Intergenic
1176008920 20:62881288-62881310 GTTTGACGCCTGGCTGGCGGGGG + Exonic
1176300705 21:5097641-5097663 GGCGGACGCGTCGCTTCCCGAGG + Intergenic
1177157243 21:17512605-17512627 GTGGGACGGGTGGGTGCAGGCGG + Exonic
1179856329 21:44164312-44164334 GGCGGACGCGTCGCTTCCCGAGG - Intergenic
1179979718 21:44889653-44889675 GGCGGCCACGTGGCTGGCGGGGG - Intronic
1181045851 22:20213938-20213960 GTGGGGCGCATGGCGGCCGGGGG - Intergenic
1184593739 22:45502508-45502530 GTCGGAGGCCCGGCTGCTGGGGG - Intronic
1185131728 22:49043278-49043300 GGCGGAAGGGCGGCTGCCGGAGG + Intergenic
949194821 3:1292183-1292205 GTAGGACTCGTGGCTGCTGGAGG - Intronic
964358482 3:155871017-155871039 CTACGACGCGTGGCTGCCCGGGG - Intronic
997286125 5:132679916-132679938 GCCGGCCGCGTGGCTCCTGGTGG + Intronic
1002424587 5:179167635-179167657 CTCGGTCGCGTGGCGGCCTGCGG - Intronic
1007451261 6:41941580-41941602 GCCGGACCCGCGGCTGCTGGGGG - Exonic
1010107084 6:72182668-72182690 GGCGGGCGCGGCGCTGCCGGAGG + Exonic
1029686698 7:102153407-102153429 GCTGGAGGCGTGGCTGCCTGGGG - Intronic
1032706170 7:134422794-134422816 TTCAGACAAGTGGCTGCCGGGGG + Intergenic
1037450797 8:19014005-19014027 GGCGGGCGCGCGGCTGCGGGAGG - Intronic
1053066461 9:35072505-35072527 GCCCGACGCCTCGCTGCCGGTGG - Exonic
1057133423 9:92670144-92670166 GCCGGGGGCGTGGCTTCCGGCGG - Exonic
1061609299 9:131735703-131735725 GTCGGAGGTGTGGCTGGCTGTGG + Intronic
1189717630 X:43882193-43882215 CTCGGACAGGTGGCTGCCTGGGG - Intronic