ID: 1113965777

View in Genome Browser
Species Human (GRCh38)
Location 13:114152879-114152901
Sequence CCAATTAGGCCCAACCTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 63}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113965777_1113965784 -8 Left 1113965777 13:114152879-114152901 CCCCTCAGGTTGGGCCTAATTGG 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1113965784 13:114152894-114152916 CTAATTGGAGCAGAATCGGAGGG 0: 1
1: 0
2: 1
3: 5
4: 68
1113965777_1113965787 -1 Left 1113965777 13:114152879-114152901 CCCCTCAGGTTGGGCCTAATTGG 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1113965787 13:114152901-114152923 GAGCAGAATCGGAGGGGCCTGGG 0: 1
1: 0
2: 0
3: 16
4: 165
1113965777_1113965783 -9 Left 1113965777 13:114152879-114152901 CCCCTCAGGTTGGGCCTAATTGG 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1113965783 13:114152893-114152915 CCTAATTGGAGCAGAATCGGAGG 0: 1
1: 1
2: 0
3: 5
4: 46
1113965777_1113965785 -7 Left 1113965777 13:114152879-114152901 CCCCTCAGGTTGGGCCTAATTGG 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1113965785 13:114152895-114152917 TAATTGGAGCAGAATCGGAGGGG 0: 1
1: 0
2: 1
3: 6
4: 99
1113965777_1113965786 -2 Left 1113965777 13:114152879-114152901 CCCCTCAGGTTGGGCCTAATTGG 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1113965786 13:114152900-114152922 GGAGCAGAATCGGAGGGGCCTGG 0: 1
1: 0
2: 1
3: 28
4: 253
1113965777_1113965789 16 Left 1113965777 13:114152879-114152901 CCCCTCAGGTTGGGCCTAATTGG 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1113965789 13:114152918-114152940 CCTGGGCTTCTTGCTGCCAGTGG 0: 1
1: 0
2: 5
3: 41
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113965777 Original CRISPR CCAATTAGGCCCAACCTGAG GGG (reversed) Intergenic
902255453 1:15186169-15186191 CCATTTACCCCCAACCTGAGGGG - Intronic
911602476 1:99861519-99861541 CCGATTAGGCCCAACTTTACAGG + Exonic
912659005 1:111512250-111512272 TCAATTAGGCACAGCTTGAGAGG - Intronic
913267161 1:117056328-117056350 CCTATTAGGCACATTCTGAGAGG - Intergenic
915650759 1:157308690-157308712 CCAATTAGGCCTGACCTCTGTGG - Intergenic
924230194 1:241956389-241956411 CCAAGTGGGCCAAACATGAGAGG + Intergenic
1071050983 10:81449167-81449189 ACAAATAAGCCCAAACTGAGAGG - Intergenic
1071189043 10:83079173-83079195 TCAATTAGGTGCAACCAGAGAGG - Intergenic
1073081274 10:100862555-100862577 CCAATGAGGCCCAACGGAAGGGG - Intergenic
1084389879 11:68868334-68868356 CCAAATAGTCCGAACCAGAGGGG + Intergenic
1089159308 11:116425153-116425175 CCAAGGAGGGCCAGCCTGAGGGG + Intergenic
1089317278 11:117600638-117600660 ACAATTAGGCCCATTCAGAGTGG + Intronic
1091603218 12:1930230-1930252 CCAAGGAGGCCCCACCAGAGAGG - Intergenic
1091856129 12:3741861-3741883 CCAATTAGGCCCAATCAGCCTGG + Intronic
1091897987 12:4120163-4120185 CCAGTTAGGTCCCACCTCAGTGG + Intergenic
1096444490 12:51676869-51676891 CCAATTCTCCCCATCCTGAGAGG - Intronic
1098213836 12:68194943-68194965 CCAACAAGGCCCAATCAGAGTGG - Intergenic
1102695546 12:114796520-114796542 CCAATTAGGACCAACATCACAGG - Intergenic
1113733391 13:112657988-112658010 CCCCTTAGTCCCAAACTGAGGGG + Intronic
1113965777 13:114152879-114152901 CCAATTAGGCCCAACCTGAGGGG - Intergenic
1126821794 15:52511665-52511687 CCAGTTAGCTCCAACCTGAGAGG - Intronic
1128114929 15:65099347-65099369 CCACTTAGGACAACCCTGAGGGG + Intronic
1128664263 15:69526852-69526874 GCAATTAGGCCCTCCCTGGGAGG - Intergenic
1134257118 16:12621699-12621721 CCAATTAGGCCAGAACTGTGAGG - Intergenic
1134862498 16:17573127-17573149 CCATTTAGGACCATCCTCAGTGG - Intergenic
1136498915 16:30659970-30659992 CCCATTAGGCCCCACCTGCAAGG - Exonic
1141690730 16:85594853-85594875 CCAATGATGCCCAAGGTGAGCGG - Intergenic
1145286174 17:21507293-21507315 CCTCTTAGGCCCAGCCAGAGAGG - Intergenic
1147757384 17:42778011-42778033 ACAACTTTGCCCAACCTGAGTGG - Intronic
1148822263 17:50366489-50366511 CCAAGGAGGCCTAACCAGAGGGG + Intergenic
1155140755 18:23042224-23042246 CCACTTAGGCACAAACTGAGAGG + Intergenic
1160821088 19:1058486-1058508 CCAATTAGACTCCAGCTGAGTGG + Intronic
1160836557 19:1127292-1127314 CCATTATGGCCCCACCTGAGAGG - Intronic
1161118991 19:2514759-2514781 CCCTTTTGGCCCAAACTGAGAGG + Exonic
1163341660 19:16711780-16711802 CCAATGATGCCCAAGCTAAGAGG - Intergenic
1163651595 19:18521316-18521338 CCAAAGTGGCCCAACCTGAGTGG + Intronic
929875349 2:45792182-45792204 GCAAAGAGGCCAAACCTGAGGGG + Intronic
930479912 2:51934896-51934918 CCAATTATACTCATCCTGAGAGG - Intergenic
935306134 2:101738323-101738345 AACATTAGGGCCAACCTGAGGGG + Intronic
936317172 2:111433341-111433363 CCCAATAGCACCAACCTGAGAGG - Intergenic
937076094 2:119108000-119108022 CCAATTAGGCCCAAGTTAACTGG - Intergenic
948571082 2:238917353-238917375 CCACTGAGCCCCAACCAGAGGGG + Intergenic
1169689914 20:8319216-8319238 CTAATTACTCCCAACCTCAGTGG + Intronic
1176993688 21:15528686-15528708 CCAATTATGTGCAACCTGGGTGG + Intergenic
954212853 3:49108251-49108273 ACAAGAAGTCCCAACCTGAGAGG + Intronic
956903018 3:73736346-73736368 GCAATTAGTCCCAACTTAAGAGG - Intergenic
959595131 3:108121405-108121427 CCAATTAGGCACACCATTAGGGG + Intergenic
963682712 3:148400229-148400251 GCAAATAGGCAAAACCTGAGGGG + Intergenic
965492071 3:169349705-169349727 GCAATTAAGCCCCACCTGACAGG - Intronic
968477948 4:821162-821184 CCAGCCAGGCCCAACCTGGGGGG - Intronic
977169545 4:93743753-93743775 CCCATTAGGCCCCACCTAATGGG + Intronic
992635167 5:78719822-78719844 CAACTCAGGACCAACCTGAGGGG - Intronic
1000963920 5:167632161-167632183 CCCAGTAGGGCCCACCTGAGAGG + Intronic
1001259688 5:170217506-170217528 GCACTTGGGCCCAATCTGAGAGG - Intergenic
1006610548 6:35291921-35291943 CCAGTTAGGTCCAATCTGAAAGG + Intronic
1020098812 7:5382935-5382957 CCACTGAGCCCCAACCTGGGTGG - Intronic
1025604018 7:63025857-63025879 CGATTCAGGACCAACCTGAGAGG - Intergenic
1036777332 8:11622639-11622661 CCAATTCAAGCCAACCTGAGTGG + Intergenic
1037797842 8:22011093-22011115 CCAATTAGGCTCACCCAGCGCGG - Intergenic
1039933802 8:42021080-42021102 CCAAATAGGGCCAAACTGAGGGG + Intronic
1040849133 8:51880285-51880307 GAAATTATGCCCAACCTCAGTGG + Intronic
1041895197 8:62916667-62916689 GAAATCAGGCCCAAGCTGAGCGG - Intronic
1043603112 8:81964793-81964815 CCAATTATTCAAAACCTGAGGGG - Intergenic
1048343082 8:133555646-133555668 CCATTTAGGACCCACCTGATTGG + Intronic
1055053769 9:72004941-72004963 CCAATCCAGCCCAAGCTGAGAGG + Intergenic
1061919591 9:133775556-133775578 GCAATGAAGCCCACCCTGAGAGG + Intronic
1190527431 X:51342130-51342152 CAAAATAGGCCCACCTTGAGTGG - Intergenic
1199818996 X:151425902-151425924 CAAATTAGCCCAAAACTGAGTGG - Intergenic
1202045147 Y:20730178-20730200 GTACTTAGGCCCAACCTGGGGGG + Intergenic