ID: 1113968449

View in Genome Browser
Species Human (GRCh38)
Location 13:114168807-114168829
Sequence TCCATTGTTTGGAGTAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113968449_1113968453 19 Left 1113968449 13:114168807-114168829 CCTCTTTTACTCCAAACAATGGA No data
Right 1113968453 13:114168849-114168871 ATGCCCTTCCAGAAGAGTGAAGG No data
1113968449_1113968457 27 Left 1113968449 13:114168807-114168829 CCTCTTTTACTCCAAACAATGGA No data
Right 1113968457 13:114168857-114168879 CCAGAAGAGTGAAGGCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113968449 Original CRISPR TCCATTGTTTGGAGTAAAAG AGG (reversed) Intergenic
No off target data available for this crispr