ID: 1113970302

View in Genome Browser
Species Human (GRCh38)
Location 13:114183598-114183620
Sequence CTGCATCCTCATATGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113970299_1113970302 -4 Left 1113970299 13:114183579-114183601 CCAAGATTGCTCCTTGTTGCTGC No data
Right 1113970302 13:114183598-114183620 CTGCATCCTCATATGGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113970302 Original CRISPR CTGCATCCTCATATGGTGAA AGG Intergenic
No off target data available for this crispr