ID: 1113974097

View in Genome Browser
Species Human (GRCh38)
Location 13:114213419-114213441
Sequence TTCCACAGGGATGGGTTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113974097_1113974108 17 Left 1113974097 13:114213419-114213441 CCACAGAACCCATCCCTGTGGAA No data
Right 1113974108 13:114213459-114213481 CCCACCCCTGTGGAAGCTCCAGG No data
1113974097_1113974104 7 Left 1113974097 13:114213419-114213441 CCACAGAACCCATCCCTGTGGAA No data
Right 1113974104 13:114213449-114213471 GACCACAGACCCCACCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113974097 Original CRISPR TTCCACAGGGATGGGTTCTG TGG (reversed) Intergenic
No off target data available for this crispr