ID: 1113981617

View in Genome Browser
Species Human (GRCh38)
Location 13:114281517-114281539
Sequence GCGCCTGACCCCTTCGTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 99}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113981612_1113981617 -8 Left 1113981612 13:114281502-114281524 CCGACTAGTCCCGCAGCGCCTGA 0: 1
1: 0
2: 0
3: 1
4: 52
Right 1113981617 13:114281517-114281539 GCGCCTGACCCCTTCGTGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 99
1113981605_1113981617 13 Left 1113981605 13:114281481-114281503 CCGGAGGTCACCACCCCGACCCC 0: 1
1: 0
2: 1
3: 26
4: 269
Right 1113981617 13:114281517-114281539 GCGCCTGACCCCTTCGTGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 99
1113981610_1113981617 -6 Left 1113981610 13:114281500-114281522 CCCCGACTAGTCCCGCAGCGCCT 0: 1
1: 0
2: 0
3: 1
4: 50
Right 1113981617 13:114281517-114281539 GCGCCTGACCCCTTCGTGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 99
1113981609_1113981617 -2 Left 1113981609 13:114281496-114281518 CCGACCCCGACTAGTCCCGCAGC 0: 1
1: 0
2: 0
3: 8
4: 61
Right 1113981617 13:114281517-114281539 GCGCCTGACCCCTTCGTGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 99
1113981604_1113981617 26 Left 1113981604 13:114281468-114281490 CCAGGCTGTGTGGCCGGAGGTCA 0: 1
1: 0
2: 3
3: 26
4: 242
Right 1113981617 13:114281517-114281539 GCGCCTGACCCCTTCGTGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 99
1113981607_1113981617 0 Left 1113981607 13:114281494-114281516 CCCCGACCCCGACTAGTCCCGCA 0: 1
1: 0
2: 0
3: 0
4: 37
Right 1113981617 13:114281517-114281539 GCGCCTGACCCCTTCGTGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 99
1113981606_1113981617 3 Left 1113981606 13:114281491-114281513 CCACCCCGACCCCGACTAGTCCC 0: 1
1: 0
2: 0
3: 10
4: 205
Right 1113981617 13:114281517-114281539 GCGCCTGACCCCTTCGTGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 99
1113981611_1113981617 -7 Left 1113981611 13:114281501-114281523 CCCGACTAGTCCCGCAGCGCCTG 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1113981617 13:114281517-114281539 GCGCCTGACCCCTTCGTGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 99
1113981608_1113981617 -1 Left 1113981608 13:114281495-114281517 CCCGACCCCGACTAGTCCCGCAG 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1113981617 13:114281517-114281539 GCGCCTGACCCCTTCGTGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113981617 Original CRISPR GCGCCTGACCCCTTCGTGGG CGG Intergenic