ID: 1113982705

View in Genome Browser
Species Human (GRCh38)
Location 13:114289591-114289613
Sequence TGTGCAGAAGAATCCACTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 313}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113982705_1113982709 25 Left 1113982705 13:114289591-114289613 CCTCCAGTGGATTCTTCTGCACA 0: 1
1: 0
2: 1
3: 34
4: 313
Right 1113982709 13:114289639-114289661 AAATACTAATAAGCTGTTTCTGG 0: 1
1: 0
2: 3
3: 14
4: 285
1113982705_1113982708 2 Left 1113982705 13:114289591-114289613 CCTCCAGTGGATTCTTCTGCACA 0: 1
1: 0
2: 1
3: 34
4: 313
Right 1113982708 13:114289616-114289638 TCTGAGAAGCAAGTGTTAAATGG 0: 1
1: 0
2: 3
3: 22
4: 366
1113982705_1113982710 30 Left 1113982705 13:114289591-114289613 CCTCCAGTGGATTCTTCTGCACA 0: 1
1: 0
2: 1
3: 34
4: 313
Right 1113982710 13:114289644-114289666 CTAATAAGCTGTTTCTGGCAAGG 0: 1
1: 0
2: 0
3: 10
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113982705 Original CRISPR TGTGCAGAAGAATCCACTGG AGG (reversed) Intronic