ID: 1113982705

View in Genome Browser
Species Human (GRCh38)
Location 13:114289591-114289613
Sequence TGTGCAGAAGAATCCACTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 313}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113982705_1113982709 25 Left 1113982705 13:114289591-114289613 CCTCCAGTGGATTCTTCTGCACA 0: 1
1: 0
2: 1
3: 34
4: 313
Right 1113982709 13:114289639-114289661 AAATACTAATAAGCTGTTTCTGG 0: 1
1: 0
2: 3
3: 14
4: 285
1113982705_1113982710 30 Left 1113982705 13:114289591-114289613 CCTCCAGTGGATTCTTCTGCACA 0: 1
1: 0
2: 1
3: 34
4: 313
Right 1113982710 13:114289644-114289666 CTAATAAGCTGTTTCTGGCAAGG 0: 1
1: 0
2: 0
3: 10
4: 151
1113982705_1113982708 2 Left 1113982705 13:114289591-114289613 CCTCCAGTGGATTCTTCTGCACA 0: 1
1: 0
2: 1
3: 34
4: 313
Right 1113982708 13:114289616-114289638 TCTGAGAAGCAAGTGTTAAATGG 0: 1
1: 0
2: 3
3: 22
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113982705 Original CRISPR TGTGCAGAAGAATCCACTGG AGG (reversed) Intronic
900434480 1:2622276-2622298 TGTGCAGATGAATCACCTGGGGG + Intronic
901579858 1:10233162-10233184 TGTGTAGAGGAGTCTACTGGTGG + Intronic
903705485 1:25282510-25282532 TGTCCAAAAGAGTCAACTGGTGG + Intronic
903721745 1:25410810-25410832 TGTCCAAAAGAGTCAACTGGTGG - Intronic
904109253 1:28112630-28112652 TATGCAGCAGAATCACCTGGAGG + Intergenic
905807864 1:40889979-40890001 TGTGCATCAGAATCATCTGGAGG + Intergenic
907743529 1:57190088-57190110 TGTGCATTAGAATCACCTGGAGG + Intronic
907743980 1:57194126-57194148 TGTGCATTAGAATCATCTGGAGG + Intronic
909713018 1:78673607-78673629 TGCACAGAAGAATCCACATGGGG + Intergenic
910877626 1:91892117-91892139 TGTGCAGAAGCCCCCAATGGAGG + Intronic
912506332 1:110159217-110159239 GGTGCTGAGGGATCCACTGGGGG - Intronic
913199738 1:116485856-116485878 TGTACTGATAAATCCACTGGAGG - Intergenic
913212500 1:116593244-116593266 TGTGCATCAGAATCAATTGGAGG - Intronic
913318626 1:117573777-117573799 TGTGCACGGGAATCCCCTGGAGG + Intergenic
913566625 1:120079215-120079237 TGTGCACAAGTATCCATGGGGGG + Intergenic
913631506 1:120714337-120714359 TGTGCACAAGTATCCATGGGGGG - Intergenic
914287383 1:146239921-146239943 TGTGCACAAGTATCCATGGGGGG + Intergenic
914548415 1:148690663-148690685 TGTGCACAAGTATCCATGGGGGG + Intergenic
914618265 1:149381048-149381070 TGTGCACAAGTATCCATGGGGGG - Intergenic
917355393 1:174121819-174121841 TGTGCATAAGCATGCACTGTGGG + Intergenic
917504571 1:175616183-175616205 TGTTCAGAAGTATTCTCTGGGGG + Intronic
918216822 1:182399203-182399225 TGTGCAAGAAAAGCCACTGGGGG - Exonic
918313133 1:183300907-183300929 TGTGCATATGAATCCTCTGGGGG + Intronic
918593314 1:186263840-186263862 TGTGCATAAGAATTGTCTGGGGG - Intergenic
920213046 1:204342523-204342545 TGTGCATATGAATCACCTGGAGG + Intronic
920405394 1:205705490-205705512 TGTGCCTCAGAATCAACTGGAGG + Intergenic
922068009 1:222162840-222162862 TGTGCAACAGAATCACCTGGAGG - Intergenic
923397715 1:233583648-233583670 TGTGCATAGGAATCACCTGGAGG - Intergenic
923473944 1:234315708-234315730 TGTGCAGAAGTTTCCACTCCTGG - Intronic
923599298 1:235387916-235387938 TGTGCATCAGAATCCCCTGGAGG - Intronic
1064126472 10:12665892-12665914 CGTGCAGATGAATCGCCTGGGGG - Intronic
1064523669 10:16230452-16230474 TGTGTATCAGAAACCACTGGAGG - Intergenic
1072495935 10:95959394-95959416 TGTGCATCAGAATCACCTGGAGG - Intronic
1072516470 10:96188222-96188244 CTTGCAGAAGAGTCCACTGAGGG - Intronic
1072782687 10:98261170-98261192 TCTGCAGCAGGCTCCACTGGAGG - Intronic
1075331612 10:121578144-121578166 TTTTCAGAAGATTCCTCTGGGGG - Intronic
1075535983 10:123272691-123272713 TGTGCAGAAGAGACAACTGTAGG + Intergenic
1075880541 10:125847075-125847097 TGTGTAAAAGAGTCCACAGGGGG + Intronic
1075880677 10:125848140-125848162 TGTGTAAAAGAGTCCACAGGGGG + Intronic
1079219871 11:18550928-18550950 TGTGCATCAGAATCATCTGGGGG - Intronic
1080692815 11:34573199-34573221 TGTACAGGAGGATCCACTGAGGG - Intergenic
1081474902 11:43419547-43419569 TATGCTGGATAATCCACTGGAGG - Intronic
1081685482 11:45039915-45039937 TGTGCATTAGAATCACCTGGAGG - Intergenic
1083608456 11:63993063-63993085 TGTGCAGTAAAATCTGCTGGAGG + Intronic
1084638356 11:70408698-70408720 TGTGTATAAAAAGCCACTGGGGG - Intronic
1085272194 11:75277020-75277042 TATGCAGAAGTCCCCACTGGTGG - Intronic
1085621980 11:78044478-78044500 TGGGCGGAAGAACCTACTGGGGG - Intronic
1087786382 11:102359685-102359707 TTTGCAGAGAAATCCACTTGTGG + Intronic
1089093826 11:115901193-115901215 GGTGCAGAAGAAAGCAATGGGGG - Intergenic
1089947372 11:122490868-122490890 CGTGCATAAGAATCATCTGGAGG + Intergenic
1090438539 11:126707711-126707733 TGCTGAGAAGAATCCACAGGGGG - Intronic
1090964648 11:131587751-131587773 TGTGCATCAGAAACAACTGGAGG + Intronic
1090988979 11:131799292-131799314 TGTGCAGAGGATTCCACTCCAGG - Intronic
1091504387 12:1052089-1052111 TGTGCATCAGAATTAACTGGAGG + Intronic
1091945318 12:4535227-4535249 TGTGCATTAGAAACCCCTGGAGG + Intronic
1093530921 12:20162138-20162160 TGTAGAGAAGAATTCACTGTAGG + Intergenic
1093595422 12:20952893-20952915 TCTGCAGAAAGATCCACTGTTGG - Intergenic
1094693338 12:32791983-32792005 ACTGCAGAACAATACACTGGAGG + Exonic
1096002351 12:48140393-48140415 CCTGCATCAGAATCCACTGGGGG - Intronic
1096332830 12:50729375-50729397 TGTACATAAGAATCACCTGGGGG + Intronic
1096385861 12:51195027-51195049 TGTGCATCAGAATCCCCTGGAGG - Intronic
1099019410 12:77384787-77384809 GGTGCAGAAAACTCCTCTGGAGG + Intergenic
1100557147 12:95706859-95706881 TGTGCATCAGAATCACCTGGAGG + Intronic
1101156784 12:101935320-101935342 TGTGCATCAGAATCACCTGGAGG + Intronic
1102546795 12:113663156-113663178 AGTGCAGAAGTCACCACTGGAGG + Intergenic
1102987889 12:117293335-117293357 TGTGCAGGACAAGCCACGGGTGG + Intronic
1102995466 12:117346700-117346722 TGTGCACATAAATCCACTGGGGG - Intronic
1103025962 12:117574218-117574240 TGTGCACAAGAATCCCCTGGAGG - Intronic
1104473817 12:129053850-129053872 TGTACATCAGAATCAACTGGGGG + Intergenic
1104998309 12:132672972-132672994 TGTGAGGAAGAAACCACAGGAGG - Intronic
1105215744 13:18283865-18283887 TGTGCATCAGAATCAATTGGAGG - Intergenic
1105420897 13:20251473-20251495 TGTGCATCAGAATCATCTGGAGG + Intergenic
1107705061 13:43094434-43094456 TGTACATTAGAATCAACTGGAGG - Intronic
1110799546 13:79679154-79679176 TGTACAGAAAATTCCACTGTTGG + Intergenic
1111658144 13:91177101-91177123 TGTGCATCAGAATCATCTGGAGG - Intergenic
1113036521 13:106055949-106055971 TGTGCATCAGAATCACCTGGAGG - Intergenic
1113539427 13:111094978-111095000 TGTTCAATAGAACCCACTGGAGG + Intergenic
1113761181 13:112847783-112847805 TGTGCAGAAAATGCCACTGGGGG + Intronic
1113982705 13:114289591-114289613 TGTGCAGAAGAATCCACTGGAGG - Intronic
1117199086 14:53370386-53370408 TGTGCAGGAGAAAGCTCTGGAGG + Intergenic
1118112866 14:62742401-62742423 TGTACACAAGAATCACCTGGGGG - Intronic
1118112978 14:62743368-62743390 TGTGCACAAGAATCACCTGGGGG + Intronic
1118354209 14:64998703-64998725 ATTGCATCAGAATCCACTGGAGG + Intronic
1118663473 14:68040855-68040877 TGTGCATGAGAATCACCTGGAGG - Intronic
1118882489 14:69841324-69841346 TGTGCATTAGAATCACCTGGGGG + Intergenic
1119165728 14:72490892-72490914 TGTGCATATGAATCACCTGGGGG + Intronic
1119510848 14:75209903-75209925 TGGGCAGAAGAGTCCAAGGGAGG - Intergenic
1119641549 14:76318917-76318939 TGTGCACAAGCATCTACAGGTGG + Intronic
1119815430 14:77562368-77562390 TTTGCTGAAGAATTCACTGCTGG - Intronic
1120140635 14:80926393-80926415 TGCACAGAAGAATCCACAAGGGG - Intronic
1120222608 14:81751498-81751520 TGTGCATCAGAATCACCTGGAGG - Intergenic
1124578343 15:30928676-30928698 TGTGCAGAAGGACCTACTCGTGG - Intronic
1125465816 15:39951354-39951376 CGTGCTTAAGAATCCACTGTGGG - Intronic
1125904651 15:43379821-43379843 TGTGCATTAGAATCACCTGGAGG + Intronic
1126362684 15:47862595-47862617 TGTGCAGATGAGTCATCTGGGGG + Intergenic
1126684469 15:51235278-51235300 TGTGCAGCAGAATCACCTGCAGG + Intronic
1127311555 15:57756060-57756082 TGTGCATATGAATCACCTGGGGG - Intronic
1127904931 15:63369496-63369518 TGAGCAGCAGAATCACCTGGAGG + Intronic
1128768072 15:70263139-70263161 TGTCCAGAAGCCTGCACTGGAGG + Intergenic
1129945594 15:79536898-79536920 TGAGCAGAGGGAGCCACTGGGGG - Intergenic
1130644138 15:85708853-85708875 TGTGCATCAGAATCAACTCGAGG + Intronic
1130899257 15:88194720-88194742 AGTGCAGGAGAAGCCACTAGAGG - Intronic
1131921731 15:97335327-97335349 GGTGAAGAATAATCCACAGGTGG - Intergenic
1133635439 16:7660809-7660831 TGTGTAGCAGAATCACCTGGAGG - Intronic
1136747714 16:32606639-32606661 TGTGCAGAAGATTCCAGCAGAGG - Intergenic
1137729739 16:50680752-50680774 TGTGTGTAAGAATCCCCTGGTGG + Intronic
1137773265 16:51035361-51035383 TGACCAGAAGAATGCAGTGGAGG - Intergenic
1137872826 16:51967079-51967101 TGTGCATCAGAATCACCTGGCGG + Intergenic
1138911195 16:61401203-61401225 TGTGCATCAGAATCACCTGGTGG - Intergenic
1138959507 16:62011645-62011667 TGTGCATAAGAATGACCTGGGGG + Intronic
1139445053 16:66992543-66992565 TGTGCATCAGAATCACCTGGAGG - Intronic
1139818860 16:69702672-69702694 TGTGCATCAGAATCACCTGGAGG - Intronic
1139920039 16:70454191-70454213 TCTGGAGAAAAATCCACTGATGG - Intergenic
1140955519 16:79861453-79861475 TGTGCTGAAGACTGGACTGGTGG - Intergenic
1141361372 16:83398081-83398103 TGTACAGCAGAATCCCCAGGAGG + Intronic
1203049849 16_KI270728v1_random:865848-865870 TGTGCAGAAGATTCCAGCAGAGG - Intergenic
1143374728 17:6460786-6460808 TGTGCATCAGAATCCCCTGGAGG + Intronic
1144099429 17:11930847-11930869 TGTGTATAAGAATCTCCTGGAGG - Intronic
1146353057 17:32112042-32112064 TGTGCAGGAATGTCCACTGGTGG + Intergenic
1146467750 17:33100068-33100090 TGTGCACACGAATCTCCTGGAGG + Intronic
1146500138 17:33357015-33357037 TGAGCATCAGAATCCCCTGGAGG + Intronic
1146721664 17:35128362-35128384 TGTGCATTAGAATACCCTGGAGG - Intronic
1146831965 17:36077270-36077292 GTTGCATCAGAATCCACTGGTGG + Intergenic
1147490684 17:40863328-40863350 CGTGCAGAAGAAATCCCTGGAGG - Exonic
1147930785 17:43979293-43979315 TGTGCAGCAGAATCACTTGGAGG - Intronic
1148681165 17:49474251-49474273 CTGGCAGAAGAAACCACTGGTGG - Intronic
1150075564 17:62188954-62188976 TGTGCATCAGAATCGCCTGGAGG + Intergenic
1150636701 17:66918300-66918322 GGTTCAGAAAAGTCCACTGGAGG - Intergenic
1151269705 17:72984647-72984669 AGTGCATGAGAATCCCCTGGAGG - Intronic
1151364002 17:73605389-73605411 TGTGGAGAAGAAAGCACAGGGGG + Intronic
1153017252 18:595283-595305 TGTTCAGAGGAATGTACTGGAGG - Intergenic
1153019734 18:616558-616580 TGTTCAGAAGAAAACACTAGAGG - Intronic
1153213361 18:2792503-2792525 GGTTCAGTAGTATCCACTGGGGG + Intronic
1154938263 18:21083930-21083952 TGTGCAGAAAAATGGAATGGCGG + Intronic
1164544162 19:29145252-29145274 TTTGCACCAGAATCCCCTGGGGG - Intergenic
1164939406 19:32240541-32240563 TGGGCAGGAAAATCCACTGTTGG - Intergenic
1167109157 19:47448645-47448667 TATGCATATGAATCCCCTGGTGG + Intronic
1168083372 19:54027001-54027023 TGTGCATCAGAATCACCTGGAGG - Intergenic
1168229985 19:55024786-55024808 TGAGCATAAGAATCACCTGGAGG - Intronic
925901932 2:8515023-8515045 TGTGCTGAAGGTTCCTCTGGTGG - Intergenic
926067386 2:9854053-9854075 TGTGCATCAGAATCACCTGGAGG - Intronic
926576702 2:14590204-14590226 TGTGCACAAGAATCACCTGGAGG - Intergenic
927340521 2:21978556-21978578 TGTGTATCAGAATCCCCTGGAGG - Intergenic
928611358 2:32995292-32995314 TGTGCATAGGAATCTCCTGGGGG + Intronic
928856476 2:35808644-35808666 TGTGCATCAGAATCACCTGGAGG + Intergenic
929267842 2:39939044-39939066 TGTGCATAAGAATCATCTGGAGG + Intergenic
929862621 2:45692686-45692708 TGTGCTGAAGAGTCCAAGGGAGG + Intronic
931141573 2:59464198-59464220 TGTACAGCAGAATCACCTGGGGG - Intergenic
932303272 2:70683632-70683654 TATGCAGAAGAGTCGGCTGGGGG - Exonic
932414003 2:71563014-71563036 TGTGCATCAGAATCCCTTGGAGG + Intronic
932568122 2:72922182-72922204 TGTCCAGAGGAAACCACTGTTGG + Intronic
932876422 2:75456965-75456987 TTTGCAGAAAGAACCACTGGGGG + Intergenic
933036166 2:77401262-77401284 TCTGCATAAGAATCCCTTGGAGG - Intronic
933250253 2:80021445-80021467 TGTGCAGAAGAATGCAGTCTTGG + Intronic
933503938 2:83153806-83153828 TGTGCATTAGAATCAACTGTAGG + Intergenic
934124041 2:88869063-88869085 TGTGCAATAGCATCCACTGGGGG + Intergenic
934298586 2:91762860-91762882 TGTGCACCAGAATCAACTGGAGG + Intergenic
938715843 2:134021101-134021123 TGTGCAGAAGCATACTCCGGTGG + Intergenic
938980283 2:136519784-136519806 TGTGCACAAGAAAGCACTTGCGG - Intergenic
940175702 2:150875484-150875506 TGTGCATCAGAATCACCTGGAGG + Intergenic
940338826 2:152557924-152557946 TTTGAAGATGAATGCACTGGAGG + Intronic
940839891 2:158568010-158568032 TGTGCATGAGAATCTCCTGGAGG + Intronic
941127082 2:161596989-161597011 TGTGCATCAGAATCACCTGGAGG + Intronic
941186945 2:162329028-162329050 TCAGCAGAAGAATACACAGGCGG - Intronic
941615384 2:167712719-167712741 AGTGCAGTAGAATCCACAGTAGG - Intergenic
941906847 2:170724886-170724908 TGTGCATTAGAATCACCTGGAGG - Intergenic
942256277 2:174102251-174102273 TGTGCATTAGAATCATCTGGAGG - Intronic
943465241 2:188220698-188220720 TGTGAAGAGAAATCCACAGGTGG + Intergenic
943720734 2:191200933-191200955 TGTGCATCAGAATCATCTGGAGG - Intergenic
943759315 2:191591293-191591315 TGTGCATCAGAATCACCTGGAGG - Intergenic
944402849 2:199347993-199348015 TGTGCATCAGAATCACCTGGAGG - Intronic
945428300 2:209735010-209735032 AGTGCAGATGAATCACCTGGAGG - Intergenic
946854439 2:223939247-223939269 TGTGCATCAGAATCACCTGGGGG - Intronic
948197617 2:236107122-236107144 TCCGCAGGAGAATCCGCTGGCGG - Intronic
948509783 2:238456081-238456103 TGTTCAGCAGCAGCCACTGGAGG + Intergenic
948632806 2:239312862-239312884 TCTGCAGATGAAGACACTGGGGG - Intronic
1168951410 20:1804461-1804483 TGTGCAAAAGCTTCCACTTGGGG - Intergenic
1169453635 20:5733279-5733301 TGTGCACCAGAATCCCCTGGAGG - Intergenic
1170002208 20:11627176-11627198 TGTGCATGAGAATCTCCTGGAGG + Intergenic
1170149552 20:13215508-13215530 TTTGCAGAAGAGGTCACTGGAGG + Intergenic
1170211573 20:13850686-13850708 TCTGGGGAAGAATCCACTGCAGG - Intronic
1172810641 20:37645497-37645519 AGTAGAGAAGAAACCACTGGGGG - Intergenic
1172947410 20:38700174-38700196 TTTGCAGATGATTCCAGTGGGGG - Intergenic
1173478638 20:43382043-43382065 TGTGCATTAGAATCACCTGGAGG - Intergenic
1175168426 20:57062823-57062845 TGAGCAGAAGAATGGAGTGGTGG - Intergenic
1175700074 20:61130572-61130594 GGGGCTGAAGAATCCACTGTGGG - Intergenic
1176324766 21:5382764-5382786 TGCTCACAAGTATCCACTGGAGG - Intergenic
1177884605 21:26733004-26733026 TGCACAGAAGAATCCACATGGGG + Intergenic
1178346519 21:31833305-31833327 TGTGCATCAGAATCACCTGGAGG + Intergenic
1178456656 21:32760636-32760658 TGTGCATCAGAATCACCTGGAGG + Intronic
1179207201 21:39292575-39292597 TGTGCATGAGAATCACCTGGAGG - Intronic
1179768485 21:43594318-43594340 TGTACAGAAGTAAACACTGGGGG + Intronic
1181349369 22:22244383-22244405 TGTACAGCAGAAGACACTGGGGG - Intergenic
1181868162 22:25875681-25875703 TGTGCATCAGAATCCCCTGGAGG - Intronic
1182670794 22:31994178-31994200 TGTGCATCAGAATCACCTGGAGG + Intergenic
1183652954 22:39169504-39169526 TGTGCAGGTGAGTCCCCTGGGGG - Intergenic
951230390 3:20172187-20172209 TGTGTATATGAATCCACAGGAGG + Intronic
952717012 3:36490019-36490041 TGTGCATCAGAATCACCTGGAGG - Intronic
952946949 3:38484368-38484390 TGTGCAGGACAATCCCCTGTGGG - Exonic
953028487 3:39159657-39159679 TGTGCATAAGAATCAATTGGAGG - Intergenic
954326601 3:49867503-49867525 CCTGAAGGAGAATCCACTGGAGG + Intronic
954719782 3:52551747-52551769 TGTGTAGAAGAATCGAGAGGAGG + Intronic
955198761 3:56830595-56830617 TGTGCAGTGGAAGCCAGTGGAGG - Intronic
955237440 3:57152020-57152042 TGTGTAGAAGGAGGCACTGGGGG - Intronic
956740138 3:72269318-72269340 TGTCCAGAAAATTCCAGTGGAGG + Intergenic
959589301 3:108059967-108059989 TGTGGAGAAGAATGCAGTGCAGG - Intronic
960151343 3:114251708-114251730 TGGGCACAAGAATCCAGTGCTGG + Intergenic
961082086 3:124035058-124035080 TGTGCAGAGGAAAAAACTGGAGG + Intergenic
961926842 3:130490287-130490309 TGTGTATCAGAATCCCCTGGAGG + Intergenic
961938455 3:130611237-130611259 AGTGCAGAAGAATCCCCTAGAGG + Intronic
963250575 3:143099361-143099383 TGTGCACCAGAATCAGCTGGAGG + Intergenic
964449906 3:156802051-156802073 TGTGCATTAGAATCCCCTGGAGG + Intergenic
965384347 3:168027910-168027932 TCTGTAGAAAAGTCCACTGGTGG - Intronic
965925418 3:173972918-173972940 TGTGCAGGAGAATCATCAGGAGG - Intronic
966178886 3:177170018-177170040 TGTGCATCAGAATCACCTGGAGG - Intronic
966293723 3:178392431-178392453 AGTCCAGAAGTATCCCCTGGAGG + Intergenic
966979184 3:185115041-185115063 TGTGCAGCAGAATCCTCTAAGGG + Intronic
967845522 3:194039570-194039592 GGTGAAGAAAAAGCCACTGGTGG - Intergenic
968149503 3:196325859-196325881 TGTGCATGAGAATCACCTGGAGG - Intronic
969937590 4:10697468-10697490 TGAGCAAAAGAAGCCACTGGTGG + Intergenic
970150565 4:13085209-13085231 TGTGCATCAGAATCACCTGGAGG + Intergenic
970714510 4:18905963-18905985 TCTGCAGAGAAATCCACTGTTGG - Intergenic
971735659 4:30447115-30447137 TGTGAAGAAGCATACACAGGAGG + Intergenic
972018795 4:34281616-34281638 TGTACAGAAGAATCTACATGGGG + Intergenic
972331123 4:38065284-38065306 TGTGCCCCAGAATCCCCTGGAGG + Intronic
972358662 4:38305875-38305897 TGTGCAGAAGAGGCCAGGGGTGG - Intergenic
972511008 4:39769159-39769181 TGTGCATCAGAATCACCTGGAGG + Intronic
973197739 4:47464471-47464493 GGTGCTGAAGAATTCAGTGGTGG + Intergenic
973834496 4:54795766-54795788 TGTGCATGGGAAGCCACTGGAGG + Intergenic
975029827 4:69601156-69601178 TGCACAGAAGAATCCACATGGGG - Intronic
975915020 4:79314415-79314437 TGTGCAAAACAATCACCTGGAGG + Intronic
976623279 4:87150959-87150981 TGTGCAGAATGAGCCACTAGAGG + Intergenic
978275796 4:106948229-106948251 TGTGCATCAGAATCACCTGGAGG + Intronic
979434595 4:120673624-120673646 TGTGCAGAAGAGTTCACAAGGGG - Intergenic
982038498 4:151371036-151371058 TGTGCACCAGAATCACCTGGAGG - Intergenic
982326008 4:154128761-154128783 TGTGCACCAGAATCCTCTGGTGG - Intergenic
982670447 4:158314097-158314119 TGTGCACAAGACTGCTCTGGGGG - Intergenic
983094130 4:163542147-163542169 TGTCATGAAGAGTCCACTGGAGG + Intronic
983454737 4:167949130-167949152 AGTGCAGTAGAATCTACTTGTGG - Intergenic
983460155 4:168016978-168017000 TTTGCTAAAGAGTCCACTGGAGG - Intergenic
983956541 4:173704959-173704981 TGGGCTGAAGAATCACCTGGTGG - Intergenic
984489753 4:180418026-180418048 TGTGCATCAGAATCACCTGGAGG - Intergenic
984632344 4:182074232-182074254 TGCTCAGCAGAATCCACTGTGGG + Intergenic
985763047 5:1761468-1761490 GGTGCAGAAGAAGCCAGCGGGGG - Intergenic
985880667 5:2636662-2636684 TTTGCACAAGACTCCACAGGGGG - Intergenic
986638439 5:9848028-9848050 TGTGCATCAGAATCACCTGGAGG - Intergenic
986780022 5:11056832-11056854 TGTGTATCAGAATCCCCTGGAGG + Intronic
990876675 5:60494241-60494263 CTGGCAGAAGAATGCACTGGGGG + Intronic
991722753 5:69509006-69509028 TGTGCACAGGAATCACCTGGAGG - Intronic
994856076 5:105121109-105121131 TGTGCAGAGGAATTACCTGGGGG - Intergenic
995278843 5:110309414-110309436 TGTGCTGAAAAATTCACTAGAGG + Intronic
996371975 5:122763213-122763235 TGTGCATCAGAATCCCCTGCAGG - Intergenic
997161629 5:131615076-131615098 TGTGCAGAAGAATCACCTGTAGG - Intronic
997336640 5:133113364-133113386 TGTGCATCTGAATCCCCTGGGGG + Intergenic
998389390 5:141777836-141777858 TGTGCATCAGAATCACCTGGAGG - Intergenic
999644311 5:153702734-153702756 TGTGCAGCAGAATCACCAGGAGG - Intronic
999817236 5:155189439-155189461 TGTGCATCAGAATCACCTGGAGG + Intergenic
1000139460 5:158387884-158387906 TGTGCACAAGAATCACCTCGGGG + Intergenic
1000452148 5:161402807-161402829 TGGGCAGGAGAATCTCCTGGAGG - Intronic
1001854043 5:174995387-174995409 TGTGAAGAAGAATGAAGTGGAGG + Intergenic
1001987330 5:176085866-176085888 ACTGCTGAAAAATCCACTGGGGG + Intronic
1002229537 5:177752276-177752298 ACTGCTGAAAAATCCACTGGGGG - Intronic
1002265808 5:178031497-178031519 ACTGCTGAAAAATCCACTGGGGG + Intronic
1003250953 6:4428862-4428884 TCTGCATCAGAATCCCCTGGAGG - Intergenic
1003976873 6:11352997-11353019 AGGGCAGGAGAATCCACTGGAGG - Intronic
1004192879 6:13479652-13479674 TCTGCAGAAGTTTCCACTGGAGG - Intronic
1004634782 6:17456219-17456241 TGTCCATCAGAATCAACTGGAGG - Intronic
1004689241 6:17977198-17977220 TGTGCATCAGAATCACCTGGAGG - Intronic
1004959986 6:20777139-20777161 TGTGCAGAAGAAACAACTTCTGG - Intronic
1006092688 6:31637278-31637300 GGTGCGGAAGACTCCACTGTAGG - Exonic
1006248953 6:32764441-32764463 TGTGAAGAAGAATTTCCTGGGGG + Intergenic
1006438120 6:34037076-34037098 TGTGCACAGGAATCATCTGGGGG - Intronic
1006972580 6:38062021-38062043 TGCACATTAGAATCCACTGGGGG + Intronic
1007152232 6:39705182-39705204 TGTGCATCAGAATCACCTGGAGG + Intronic
1010208080 6:73340966-73340988 TGTGCATCAGAATCACCTGGAGG + Intergenic
1010444043 6:75931385-75931407 TGTGCATCAGAATCGTCTGGAGG + Intronic
1010685049 6:78844785-78844807 TGTGCGTCAGAATCAACTGGAGG - Intergenic
1011229066 6:85139511-85139533 TGTGCATAAAAATCATCTGGGGG - Intergenic
1011786790 6:90855625-90855647 CAGGCAGTAGAATCCACTGGAGG + Intergenic
1012107764 6:95186925-95186947 TGTGCAGAATAAGCAGCTGGAGG - Intergenic
1012257549 6:97051086-97051108 TGTGCTGAGGAACCCACTGTGGG + Intronic
1012354849 6:98301224-98301246 TGTGCAGATGAATCACCTGGAGG - Intergenic
1012394146 6:98776279-98776301 TGTGCATTAGAATCACCTGGAGG - Intergenic
1012871815 6:104682151-104682173 TGTGCATCAGAATCACCTGGAGG + Intergenic
1013104050 6:107011223-107011245 TGTGCATCAGAATCACCTGGAGG + Intergenic
1013646476 6:112146528-112146550 TGTGCATTAGAATCACCTGGAGG - Intronic
1014013215 6:116500567-116500589 TCTAGAGAAGAATCCCCTGGTGG - Exonic
1015126685 6:129763073-129763095 AGTGCAGTGGAAGCCACTGGAGG - Intergenic
1015550984 6:134412264-134412286 TGTGCATCAGAGTCCTCTGGAGG + Intergenic
1015896181 6:138019274-138019296 TGTGCATCAGAATCCCCTGGAGG - Intergenic
1017821203 6:158050219-158050241 TGTGCATAGGAATCTCCTGGAGG + Intronic
1018326696 6:162677922-162677944 TGGGAGGAAGAATCTACTGGGGG - Intronic
1018947258 6:168356554-168356576 TGTGCAAAAGCATCCACTTCTGG + Intergenic
1020971869 7:14953821-14953843 TGTGCAGTAGAGTCAACTGGGGG - Intronic
1021182270 7:17520437-17520459 TGTGCAAAGGAAGCCCCTGGGGG + Intergenic
1021754980 7:23843086-23843108 TGTGCAGAAGAACTCACCAGGGG + Intergenic
1022190570 7:28013417-28013439 TGTGCATCAGAATCACCTGGAGG + Intronic
1023413413 7:39909951-39909973 TGCACAGAAGAATCCACATGGGG - Intergenic
1024443392 7:49447824-49447846 TCTGCAGAAAAATCCACTAGTGG - Intergenic
1024523069 7:50324484-50324506 TATGCAGAAGAAACCACATGGGG - Intronic
1024675979 7:51638291-51638313 TCTGCAGGAGCATCAACTGGGGG - Intergenic
1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG + Intronic
1027845352 7:83365945-83365967 TTTACCCAAGAATCCACTGGAGG - Exonic
1029354257 7:100039387-100039409 TGTGCAGATGCATCCAGTCGTGG + Exonic
1029822168 7:103157005-103157027 TATGCAGTATAATCCAGTGGGGG - Intergenic
1030516037 7:110539038-110539060 TATTCAGAAGAATTCAGTGGGGG - Intergenic
1032608239 7:133381978-133382000 TGTGCATAAGAATCACCTGAAGG - Intronic
1035660221 8:1342107-1342129 TGTACAGAAAAATCAGCTGGGGG - Intergenic
1036810416 8:11864530-11864552 TGTGCAGAAGAATCCAAAAGAGG + Intronic
1039666434 8:39536396-39536418 TTTGGAGAAGAATCCATTGGTGG - Intergenic
1043150437 8:76707856-76707878 TATGCAGAAATATCAACTGGTGG + Exonic
1043642922 8:82479505-82479527 TGTGCACCAGAATCACCTGGAGG + Intergenic
1044112928 8:88298636-88298658 TGTGCAGATGAATCACCAGGAGG - Intronic
1044201758 8:89446506-89446528 TGTGCATCAGAATCCCCTAGAGG + Intergenic
1044203434 8:89463471-89463493 TGTGCATAAGAATCACCTTGGGG + Intergenic
1044841237 8:96338814-96338836 TGTGCACAAGAATCCAGGGGAGG - Intergenic
1045183414 8:99811420-99811442 TATGCATCAGAATCCCCTGGAGG + Intronic
1048579459 8:135719214-135719236 TGTGCAGAGGAATCACCTGGGGG + Intergenic
1049434846 8:142581756-142581778 TGTGCAGAAGAGGCCTCTGGGGG - Intergenic
1050529445 9:6575517-6575539 TGTGCATGAGAATCACCTGGAGG - Intronic
1051390691 9:16560068-16560090 TGTGCATCAGAATCAAGTGGAGG + Intronic
1053226698 9:36364733-36364755 TGTGCATTAGAATCACCTGGAGG + Intronic
1054759293 9:68990338-68990360 TGTGCCTCAGAATCCCCTGGTGG - Intronic
1055362496 9:75508427-75508449 TTTGCATAAGAAGCCACTAGTGG + Intergenic
1057715907 9:97495715-97495737 TGTGGAGAAGAAACCTCTGGTGG + Exonic
1057923718 9:99122907-99122929 TGTGCAGAATTTTCCACTTGTGG - Intronic
1059971831 9:119676179-119676201 TTTGTTGAAGAATCCACAGGTGG + Intergenic
1060102096 9:120849618-120849640 TGTGCACAGAAATCCCCTGGGGG - Intergenic
1060151865 9:121294110-121294132 TGAGCAGGAGAAGCCACAGGAGG - Intronic
1061561239 9:131405195-131405217 AGTGCAGAAGCGGCCACTGGAGG + Intronic
1185639000 X:1576068-1576090 TGAACAGAAGAATCGACTGATGG + Intergenic
1186257015 X:7732900-7732922 TGTGCAGAGAAATCCCCTGGGGG - Intergenic
1186628314 X:11319336-11319358 TATGCATCAGAATCCTCTGGAGG + Intronic
1187338783 X:18403184-18403206 TGAGCAGATGAATACAGTGGAGG + Intergenic
1187516288 X:19974333-19974355 TGTGCATTAGAATCGCCTGGAGG + Intergenic
1187528579 X:20076015-20076037 TGTGCATCAGAATCCATTAGAGG + Intronic
1187562487 X:20415639-20415661 CGTGCATCAGAATCCCCTGGAGG - Intergenic
1187799957 X:23050565-23050587 TGTACATCAGAATCAACTGGAGG + Intergenic
1188037429 X:25334310-25334332 TGTGCAAAAGAATTAACTGTGGG + Intergenic
1188362686 X:29275287-29275309 TGTGCATCAGAATCACCTGGAGG - Intronic
1188557190 X:31426070-31426092 TATGCATCAGAATCCCCTGGGGG - Intronic
1189124018 X:38426320-38426342 TGTGCATCAGAATCCCCTGGAGG + Intronic
1190399363 X:50016191-50016213 TGTGCATCAGAATCACCTGGAGG - Intronic
1190938616 X:55019032-55019054 TGTGCTGAAGAATCAGCAGGAGG + Intronic
1195047262 X:101065352-101065374 TGTGCATCAGAATTCTCTGGAGG + Intergenic
1195749731 X:108151794-108151816 TTTGCAGAAAAATCCCTTGGGGG - Exonic
1196111422 X:111951159-111951181 TGTACATGAGAATCCTCTGGAGG + Intronic
1196260963 X:113580981-113581003 TGAGCTGAAAAATCCACTAGAGG - Intergenic
1196565568 X:117200339-117200361 TGTGCATATGAATCACCTGGAGG + Intergenic