ID: 1113984555

View in Genome Browser
Species Human (GRCh38)
Location 13:114303452-114303474
Sequence CTGTATACACAGATGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 200}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113984555_1113984564 21 Left 1113984555 13:114303452-114303474 CCATGCTCCATCTGTGTATACAG 0: 1
1: 0
2: 2
3: 18
4: 200
Right 1113984564 13:114303496-114303518 GAATTGTCGGCCCGGTGCGGTGG 0: 1
1: 2
2: 19
3: 279
4: 2016
1113984555_1113984561 8 Left 1113984555 13:114303452-114303474 CCATGCTCCATCTGTGTATACAG 0: 1
1: 0
2: 2
3: 18
4: 200
Right 1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG 0: 1
1: 0
2: 4
3: 23
4: 204
1113984555_1113984562 13 Left 1113984555 13:114303452-114303474 CCATGCTCCATCTGTGTATACAG 0: 1
1: 0
2: 2
3: 18
4: 200
Right 1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG 0: 1
1: 1
2: 5
3: 23
4: 251
1113984555_1113984563 18 Left 1113984555 13:114303452-114303474 CCATGCTCCATCTGTGTATACAG 0: 1
1: 0
2: 2
3: 18
4: 200
Right 1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG 0: 1
1: 0
2: 0
3: 7
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113984555 Original CRISPR CTGTATACACAGATGGAGCA TGG (reversed) Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
902712212 1:18248229-18248251 CTGTGTACACAGTGGGAGCCTGG + Intronic
903874945 1:26467534-26467556 CTGGAGACAGACATGGAGCAGGG - Intronic
904786690 1:32988214-32988236 TTGTATACATAGCTGGAGCCTGG - Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
905485734 1:38294892-38294914 CTGTATCCTCATATGGAGGAAGG + Intergenic
906772119 1:48494595-48494617 GAGTATACTCTGATGGAGCAAGG - Intergenic
910054707 1:83018889-83018911 ATGTATACACATATATAGCAGGG - Intergenic
911545015 1:99206135-99206157 CTGCATCCACATATGGAGGAAGG + Intergenic
912207595 1:107525579-107525601 GTGTATACACAGATGGAAGTTGG + Intergenic
912252459 1:108025722-108025744 CTGCAGCCACAGCTGGAGCAAGG - Intergenic
914684228 1:149964283-149964305 TTGTATGCACTGATGGAGAAGGG - Exonic
920510402 1:206547315-206547337 CTGTAAATACAGATGAAGCGTGG - Intronic
921162677 1:212484207-212484229 CTGTTTACAAAGATGGGACAGGG - Intergenic
1066997833 10:42580006-42580028 GTGTATTCACTGATGGAGGAAGG + Intronic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1068082248 10:52333528-52333550 CTGTAGACACAAATATAGCAAGG - Intergenic
1070012238 10:72487435-72487457 CTGTAACCACAGATGAAACATGG + Intronic
1070971049 10:80567566-80567588 CTATATACAGTGCTGGAGCAGGG + Intronic
1072051220 10:91705474-91705496 CTGTCAACCCAGATGGAGTAGGG - Intergenic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1076206197 10:128605964-128605986 CTGTATACACACATGAAGCGAGG - Intergenic
1082171659 11:49012376-49012398 CGGAATGCAGAGATGGAGCAGGG + Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1085751702 11:79167816-79167838 CTGTGGACACAGAAGGAGCCTGG - Intronic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1087879347 11:103396758-103396780 CTGTATACACACACACAGCATGG + Intronic
1088035633 11:105310621-105310643 CTGAATAGAAAGATGGAACAGGG - Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1098990373 12:77059299-77059321 CAGGACAGACAGATGGAGCAAGG - Intronic
1099996162 12:89781356-89781378 CTCTATACACAGACTGAGAAGGG - Intergenic
1100882221 12:99031617-99031639 CTGCATTCCCAGATGGAGGAAGG - Intronic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1106573619 13:30954001-30954023 CTGTTTACTCAGCTGGAACATGG + Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107892602 13:44927399-44927421 CTGTGTACACAGATGGGCAATGG - Intergenic
1108000636 13:45902669-45902691 CTTAATACTCAGATGGAGCTGGG - Intergenic
1112267588 13:97939314-97939336 CTGCATGCACAGATGCACCAGGG - Intergenic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114576606 14:23719989-23720011 ATTTTTCCACAGATGGAGCAGGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114889243 14:26896082-26896104 CTGGATATCCAGCTGGAGCAAGG + Intergenic
1116797478 14:49407440-49407462 CTGTTTACAGAGATTTAGCAGGG - Intergenic
1118448353 14:65872841-65872863 TTGTTTACATAGATGCAGCAAGG + Intergenic
1118725670 14:68627387-68627409 GTGTGTCCACAGTTGGAGCAGGG + Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119746034 14:77044798-77044820 CTGTAAACAGAGAAGCAGCAAGG - Intergenic
1120700272 14:87691462-87691484 CTCTATACACATAGTGAGCAAGG + Intergenic
1124442612 15:29698246-29698268 CTGTGTACACAGATGCATCCGGG - Intergenic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1126289358 15:47056223-47056245 CTGTTTACAGAGATGTAGCTAGG + Intergenic
1128355730 15:66925173-66925195 ATGAATTCACAGATGGAGCCTGG + Intergenic
1128692656 15:69737015-69737037 TTGTATCCACAGAAGGAGGAAGG + Intergenic
1129063220 15:72878262-72878284 CTGTATCCTCACATGGAGGAAGG + Intergenic
1131522483 15:93126900-93126922 CAGTGGACACAGCTGGAGCAGGG + Intergenic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135481069 16:22821039-22821061 CTGGCTACAGAGATGAAGCAGGG - Intronic
1135801793 16:25504074-25504096 CTGGGTACACATATGGAGAATGG + Intergenic
1137495374 16:48965313-48965335 CTGTGTAGACAGATGAAGGAGGG + Intergenic
1139740968 16:69034500-69034522 CTGTAACCACAGCTGGAGCCTGG - Intronic
1140866228 16:79064944-79064966 GTGTTTATAGAGATGGAGCATGG + Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG + Intergenic
1144823025 17:18088641-18088663 CTGTGTACTAAGATGGAGCAGGG - Intronic
1146409140 17:32566984-32567006 CTGTGAACATGGATGGAGCACGG - Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1149046299 17:52249680-52249702 CTGTAGACAGGCATGGAGCAGGG + Intergenic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1151104236 17:71594004-71594026 CTGTATACACTGTTGGTCCATGG + Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1160131198 18:76226315-76226337 CTGCACACACAGAAGGAGAAAGG + Intergenic
1160131317 18:76227285-76227307 CTGCACACACAGAAGGAGAAAGG + Intergenic
1162153293 19:8660342-8660364 CTGTAGACACAGAGGGGGAATGG + Intergenic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1164424057 19:28124528-28124550 CTGTCCAGACAGATGCAGCAAGG - Intergenic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1165279247 19:34782650-34782672 CTGTCCTCACAGCTGGAGCATGG - Intergenic
1165413367 19:35676033-35676055 ATGGATAGACAGATGGAGCAGGG - Intronic
1166189553 19:41166920-41166942 CTGCAACCACAGAGGGAGCAGGG - Intergenic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
1167945680 19:52986701-52986723 TTGAATGCAAAGATGGAGCAAGG - Intergenic
925121983 2:1426664-1426686 CTGTCTTTACAGAAGGAGCATGG - Intronic
925567123 2:5268528-5268550 CAGTATACAAATATGTAGCATGG - Intergenic
925904263 2:8529868-8529890 GTGTATACACGCATGGGGCAGGG - Intergenic
927061319 2:19424946-19424968 CTGGATATACAGATGGAGACTGG - Intergenic
927441209 2:23119341-23119363 CTGTCCACACAGATGGTGGAGGG + Intergenic
930505714 2:52280990-52281012 CTGTGTTCTCAGATGGAGGAAGG + Intergenic
936434254 2:112489980-112490002 CAGTATTCACTGATGGAGAAGGG - Intronic
936666649 2:114604465-114604487 CTGTACACGCAGATGGGTCAGGG - Intronic
936949784 2:117966298-117966320 TTTTATACACTGATGGAGGAAGG + Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938682835 2:133709661-133709683 CGGTACACACAAATGGAGCCAGG + Intergenic
939651286 2:144765669-144765691 CTTTATAGACAGATAGAGCTTGG - Intergenic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
943090729 2:183371769-183371791 CTGTAGACAGAGTTGGTGCAGGG - Intergenic
943325458 2:186492121-186492143 CTGTAGTTACAGATGGAGCATGG + Intronic
946815115 2:223569128-223569150 CTGTATTCACATGTGGAGCCTGG - Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169210780 20:3765246-3765268 CTGTGGACACAGCTGCAGCAGGG - Intronic
1170939779 20:20839369-20839391 CTGGATGCACAGATAGAGCTTGG + Intergenic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1173022597 20:39279663-39279685 ATAAATAAACAGATGGAGCATGG + Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175190289 20:57207362-57207384 CTGTAGTCACTGATGGAGCTAGG - Intronic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1176185448 20:63775881-63775903 CTCTATGCACAGGTGGAGGAGGG - Exonic
1176937274 21:14881980-14882002 CTGTATACTCACATGGTGGAAGG + Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1179139908 21:38716095-38716117 CTTTATACAGGGATAGAGCATGG - Intergenic
1179154483 21:38838257-38838279 CTGCAGAGACAGTTGGAGCATGG - Intergenic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1180865771 22:19118847-19118869 TTCTCTACACAGATGGAGAAAGG + Intronic
1181737496 22:24893241-24893263 CTGAAGACACAAAGGGAGCAAGG - Intronic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1183716934 22:39538562-39538584 CCTTGTCCACAGATGGAGCAGGG - Intergenic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
951649594 3:24936153-24936175 CTCTATACAAACATGGACCATGG - Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
955485015 3:59426427-59426449 CTGTCTTCAAAGATGGAGAAAGG - Intergenic
956663110 3:71618483-71618505 CTCTAGTCACAGATGGATCATGG - Intergenic
958145599 3:89620583-89620605 CTGTATTCACAGGTGTAGCAAGG - Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
970155686 4:13139756-13139778 CTCTATTCACTGATGGAGCTGGG - Intergenic
970950911 4:21754285-21754307 CTGTATAGACAAATAAAGCAAGG - Intronic
972624029 4:40778527-40778549 CTGTATCCTCAGATGGTGAAAGG - Intronic
972703076 4:41513450-41513472 CCGGATACACAAATGGGGCAAGG - Intronic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
979411219 4:120382532-120382554 CTATATATTCACATGGAGCACGG - Intergenic
980615567 4:135219007-135219029 CTGTATATTAAAATGGAGCATGG - Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981679695 4:147382192-147382214 CCGTCTACAGAGATGGAGAAAGG + Intergenic
983027042 4:162750833-162750855 CTGTATGCACAGATGTTTCATGG - Intergenic
983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG + Intronic
984865127 4:184274638-184274660 CAGTATGCACAGATGGTGAAAGG - Intergenic
986487290 5:8250457-8250479 CTGTATAGCAACATGGAGCATGG + Intergenic
988600147 5:32632172-32632194 CTGCCTCCACAGATGGAGCAAGG - Intergenic
991202263 5:64008296-64008318 CTGTAAACACTGAGGAAGCATGG - Intergenic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
992553819 5:77884416-77884438 CTGTATATACAGAGTGAGAAAGG + Intergenic
993164584 5:84335927-84335949 CTGTTTCCTCAGATGGAGGAAGG + Intronic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
994974826 5:106788641-106788663 CTGTATACTCATAATGAGCATGG + Intergenic
995783485 5:115802923-115802945 CTATATACACATATTCAGCATGG - Intergenic
996058069 5:119001982-119002004 CTGGCTTCACAGATGGAGGATGG - Intergenic
999805481 5:155077298-155077320 CTTTAGTGACAGATGGAGCATGG - Intergenic
1001318220 5:170659564-170659586 CTCTATACAAAGAAGGAGAAAGG - Intronic
1003776731 6:9375198-9375220 CTGTATAAACACATGCACCATGG + Intergenic
1004327268 6:14686698-14686720 CTGTAAAAACAGATGAAGCCTGG + Intergenic
1004730483 6:18353361-18353383 ATGTATAAACTGATGGAGGAGGG + Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005484895 6:26290334-26290356 CTGAATGCAAAGATGGAACAAGG - Intergenic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1008469794 6:51871531-51871553 GTGGCTACAAAGATGGAGCAAGG + Intronic
1008483871 6:52014554-52014576 CTGGATAAACAGATGGATCATGG + Intronic
1011713467 6:90079214-90079236 CTGTAGACACAGATGTTGGAGGG - Intronic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1013807353 6:114010685-114010707 CTGTCTACACACAGGGATCAGGG + Intronic
1014358985 6:120451778-120451800 GTGTTTACAGAGATGTAGCAAGG + Intergenic
1014512571 6:122342212-122342234 CTGGCTTCACAGATGGAGAATGG + Intergenic
1015603524 6:134933392-134933414 CTGGACACCAAGATGGAGCAGGG - Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1019275449 7:173269-173291 CTGTGTCCACAGATGGGGCAGGG + Intergenic
1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG + Intronic
1024186879 7:46958472-46958494 CTGTATACTCAGAAAGATCAGGG + Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1026850206 7:73719197-73719219 CTGTCTACACCGAGGGGGCACGG + Intronic
1028423348 7:90658359-90658381 CTGTATACTCAGATGGTAGAAGG + Intronic
1028926367 7:96360924-96360946 CTATACACATAAATGGAGCAGGG + Intergenic
1030498159 7:110326180-110326202 CTGCATATTAAGATGGAGCATGG + Intergenic
1031644448 7:124206561-124206583 ATGTATACAGAGAAGGAACAAGG - Intergenic
1031910030 7:127506214-127506236 CTAAATACACAGCTAGAGCAAGG - Intergenic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1041116164 8:54539627-54539649 CTCTATTAACAGATGGAGGAAGG - Intergenic
1043231178 8:77803317-77803339 GCTTATTCACAGATGGAGCACGG + Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043875794 8:85484603-85484625 CAGCAGACACAGATGGAGCCAGG - Intergenic
1044687700 8:94843657-94843679 CTGTATACACATATGATGGAGGG + Intronic
1046024054 8:108700802-108700824 AGGTTTACACAGCTGGAGCATGG + Intronic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1047721162 8:127641006-127641028 CTGTCTCCCCAGATGGAGCATGG - Intergenic
1047954530 8:129963382-129963404 GGCTATACACAGATGAAGCAAGG + Intronic
1048646035 8:136420796-136420818 CTGTAAACACCGAGGGAGAATGG + Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1048951277 8:139498909-139498931 CTACACACACAGATGGGGCAAGG - Intergenic
1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG + Intronic
1052283237 9:26756219-26756241 CTGTGTACTCACATGGAGGAAGG + Intergenic
1052443007 9:28521970-28521992 CTGTATCCATCGAGGGAGCATGG + Intronic
1052528803 9:29655897-29655919 CTGAATGCAAAGATGGAACAAGG - Intergenic
1053244414 9:36522877-36522899 GTGTATACACACATGGAAAATGG + Intergenic
1055342489 9:75299176-75299198 GTGTCCACACAGATGAAGCATGG - Intergenic
1057744885 9:97742932-97742954 CTGCTTACAGAGATGCAGCAAGG - Intergenic
1059284027 9:113157497-113157519 CTCTATTCTCATATGGAGCATGG + Intronic
1059438076 9:114288443-114288465 CTGTGTCCACAGGGGGAGCAGGG + Exonic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1060766614 9:126298718-126298740 CAGTAGAAACAGCTGGAGCAAGG - Intergenic
1060834562 9:126745355-126745377 ATTAATACAGAGATGGAGCAAGG + Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1189545848 X:42042052-42042074 CTCTATACACACATGGAGAGAGG + Intergenic
1190303391 X:49068914-49068936 CTGTAAACATAAATGGAGGAAGG - Intronic
1191724885 X:64268895-64268917 CTGAATACCCTGATGGAGAATGG - Exonic
1196199745 X:112872102-112872124 CTGTTTACACAAAAGGAGGAGGG - Intergenic
1199188091 X:144939852-144939874 CTGGATCCACAGCTGTAGCAGGG + Intergenic
1199579316 X:149345523-149345545 CCGTACACACAGAAGGGGCATGG - Intergenic