ID: 1113984557

View in Genome Browser
Species Human (GRCh38)
Location 13:114303459-114303481
Sequence GCAATACCTGTATACACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113984557_1113984564 14 Left 1113984557 13:114303459-114303481 CCATCTGTGTATACAGGTATTGC 0: 1
1: 0
2: 0
3: 20
4: 120
Right 1113984564 13:114303496-114303518 GAATTGTCGGCCCGGTGCGGTGG 0: 1
1: 2
2: 19
3: 279
4: 2016
1113984557_1113984561 1 Left 1113984557 13:114303459-114303481 CCATCTGTGTATACAGGTATTGC 0: 1
1: 0
2: 0
3: 20
4: 120
Right 1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG 0: 1
1: 0
2: 4
3: 23
4: 204
1113984557_1113984563 11 Left 1113984557 13:114303459-114303481 CCATCTGTGTATACAGGTATTGC 0: 1
1: 0
2: 0
3: 20
4: 120
Right 1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG 0: 1
1: 0
2: 0
3: 7
4: 112
1113984557_1113984562 6 Left 1113984557 13:114303459-114303481 CCATCTGTGTATACAGGTATTGC 0: 1
1: 0
2: 0
3: 20
4: 120
Right 1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG 0: 1
1: 1
2: 5
3: 23
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113984557 Original CRISPR GCAATACCTGTATACACAGA TGG (reversed) Intronic
902284268 1:15396357-15396379 GCAATATCTGTATACCTGGAAGG + Intronic
903591515 1:24459653-24459675 GCAGTTCCTGTCTACACAGGAGG + Intronic
906338844 1:44960223-44960245 GCAGTACCTGCAGATACAGAGGG - Intronic
907546757 1:55267208-55267230 GGAATAACTGAATACCCAGAAGG - Intergenic
909360813 1:74757074-74757096 GCAACACCTGGATGCCCAGATGG + Intronic
911262143 1:95699447-95699469 TCAATACTTGTAAACACAGAAGG + Intergenic
914436647 1:147666509-147666531 GTAATACCAGTATACAGACAAGG - Intronic
915989219 1:160496387-160496409 ACATTCCCTGTAAACACAGAAGG + Exonic
916963369 1:169911106-169911128 GCTATACCTGTCTATATAGATGG - Intergenic
918361659 1:183765006-183765028 TAAATATCTGTAGACACAGATGG - Intronic
918386169 1:184010369-184010391 TAAATACCTGTAGACACAGTTGG - Intronic
918516088 1:185365335-185365357 GCATTATCTATATACACAGAGGG + Intergenic
918921846 1:190722291-190722313 GGAATACATGCATACACATAGGG - Intergenic
921040727 1:211429208-211429230 GCAAAACCTGCATATACTGAGGG + Intergenic
923509356 1:234636538-234636560 GCAATTCCTGTTTCCACAAAGGG + Intergenic
924159144 1:241212190-241212212 GTAATAACTGGATACACTGAAGG + Intronic
1063480075 10:6367747-6367769 GCAATCCCTGTATCCCCAGTAGG + Intergenic
1064039896 10:11952421-11952443 TCAAGACCTGTATAGACAGAGGG - Intronic
1070662725 10:78319151-78319173 GAAATACCTGTAGACAGAGGAGG - Intergenic
1074561089 10:114535859-114535881 GCAAAACCTCTGTACACAGAGGG + Intronic
1076149843 10:128153195-128153217 GGAATTCCTGTAGAAACAGAGGG - Intergenic
1077699699 11:4430255-4430277 GCCTTACCTGCATACAGAGATGG + Intergenic
1080358754 11:31487779-31487801 GGAATAACTGTACACACTGAAGG - Intronic
1081585208 11:44379592-44379614 CACATACCTGTATACACAGACGG + Intergenic
1081921152 11:46778696-46778718 GTAATACCTATTTACACAGTAGG + Intronic
1082954371 11:58853376-58853398 TCAAAACCTGTGTACACAGAAGG + Intronic
1085997782 11:81942302-81942324 ACAATACTTATATAAACAGATGG + Intergenic
1086206601 11:84266132-84266154 GCAATACTGGAATACAAAGAAGG + Intronic
1088566763 11:111180778-111180800 CTAATCCCGGTATACACAGAGGG + Intergenic
1089891334 11:121884382-121884404 GCAATCCCATTCTACACAGATGG - Intergenic
1089905016 11:122029803-122029825 GCAATACCTGCACACACTGTGGG + Intergenic
1090497560 11:127229389-127229411 GCAAAACTTAGATACACAGATGG + Intergenic
1090599179 11:128352641-128352663 GCAAAACCAGTGTACACAGTAGG + Intergenic
1094488138 12:30941188-30941210 GCAAAACCCATATATACAGAGGG + Intronic
1098372112 12:69770534-69770556 GCAGAACCTGTGTACACAGAGGG + Intronic
1102798190 12:115707715-115707737 GCAATATCTGGAGACACTGAAGG + Intergenic
1103202026 12:119095561-119095583 GTAAGTCCTCTATACACAGAAGG + Intronic
1104001144 12:124861415-124861437 GCAGAACCTGCAGACACAGAGGG + Intronic
1106275568 13:28202613-28202635 GGATTACTTGTATACACAGCAGG + Intronic
1112703620 13:102040354-102040376 ACAATACCTTTTTACATAGAGGG + Intronic
1113984557 13:114303459-114303481 GCAATACCTGTATACACAGATGG - Intronic
1114722570 14:24898015-24898037 GAAACACATGCATACACAGATGG - Intronic
1116531305 14:45977109-45977131 GCATTTCCTGAATCCACAGATGG + Intergenic
1119601711 14:75981130-75981152 GCAAAACCTGTTTAGACACATGG - Exonic
1120219009 14:81711791-81711813 GCATTGCCTATATACACACACGG - Intergenic
1120707425 14:87759330-87759352 GCAATCCCAATAAACACAGATGG + Intergenic
1121382435 14:93484832-93484854 GCAATACTTACATAAACAGACGG - Intronic
1125095397 15:35844437-35844459 GCAACAACTGTATAAACAGTGGG + Intergenic
1126350781 15:47742832-47742854 GCAAAACCAGGAAACACAGAGGG - Intronic
1127353482 15:58175301-58175323 TCAATCCCTGTAGACACAAATGG + Intronic
1129160450 15:73744710-73744732 GAAATAATTATATACACAGAAGG + Intronic
1132895374 16:2226646-2226668 ACAGTACCTGTTTACACAAAGGG - Intronic
1135840351 16:25870482-25870504 GGAAAAACTGTATAGACAGAAGG + Intronic
1144455011 17:15411795-15411817 GCAATGCCTGTCTTCACTGAAGG - Intergenic
1146706507 17:35004257-35004279 GCAATACCTGCAAATGCAGAGGG - Exonic
1150900162 17:69265409-69265431 GCTATACCAGTGTACACAAAAGG - Intronic
1151963952 17:77421593-77421615 GCCATCCCTGTACACGCAGAGGG - Intronic
1152854401 17:82655901-82655923 GCAAAGCCTGTATTCAGAGATGG - Exonic
1153692159 18:7604692-7604714 GCAGTAACTGTATACAGAAAGGG + Intronic
1157321254 18:46636346-46636368 GCCCTACCTGTAGGCACAGAAGG - Intronic
1158187973 18:54792974-54792996 GCAAAATCCGTATATACAGAAGG - Intronic
1162563550 19:11432206-11432228 GCAAAACCTGAGTATACAGAGGG - Intronic
1168173157 19:54603585-54603607 GCACTATATGTATACACACACGG - Intronic
926855113 2:17247502-17247524 CCAATACCAGGATACAGAGAAGG - Intergenic
928229372 2:29483237-29483259 GCAATACCAGTATACAGACAGGG - Intronic
928343155 2:30463493-30463515 GCAAAACCTGTGGATACAGAGGG - Intronic
928776688 2:34773034-34773056 GCATTACATATATACACATATGG - Intergenic
930442074 2:51421212-51421234 GCAAAACCTGTGTACAATGAGGG + Intergenic
931110458 2:59105154-59105176 GGAATAGCTGGATAAACAGAGGG + Intergenic
932000698 2:67881686-67881708 ACAAGACCTGTAGACACAAATGG + Intergenic
932092074 2:68815164-68815186 GCAATGCATGTCTACACACAGGG + Intronic
936368982 2:111886910-111886932 GCAATATTTGTATATTCAGATGG + Intergenic
939657161 2:144841168-144841190 GTAATACATGTATACTCAGTAGG + Intergenic
939928588 2:148203801-148203823 GCAATACCTGTAGCAACATAAGG + Intronic
941644523 2:168025716-168025738 GCAATATGAGGATACACAGAAGG + Intronic
942601345 2:177644001-177644023 GAAATGCCTGTATATCCAGAAGG + Intronic
943791939 2:191942957-191942979 GCAAACTCTGTATACACAGAAGG + Intergenic
947142699 2:227034116-227034138 GTAATGTCTGTTTACACAGACGG - Intronic
1169322761 20:4647746-4647768 GCAAAACCTGTGTATACAGAGGG + Intergenic
1169634518 20:7673858-7673880 GCAAATTCTGTATTCACAGATGG + Intergenic
1169673746 20:8132277-8132299 GCACATCCTCTATACACAGAGGG - Intronic
1181814584 22:25428791-25428813 GAAACATCTGTATACACACACGG - Intergenic
1184686782 22:46099813-46099835 GCCCTCCCTGTATACACAGCTGG + Intronic
949424449 3:3901534-3901556 GAAATAACTGTATACAAAGAGGG + Intronic
951914500 3:27785863-27785885 GAAATTCCTGGATACACAGAAGG + Intergenic
952408115 3:33023611-33023633 GGAAAACCTGAAGACACAGATGG + Intronic
955493182 3:59503486-59503508 ACAACACATGAATACACAGAGGG - Intergenic
955829882 3:62989908-62989930 GCAAAAGCTGTATAAACAGAAGG - Intergenic
959863128 3:111237683-111237705 GCAGTAGCTTTATTCACAGATGG + Intronic
960089642 3:113626418-113626440 TCAATATCTTTAGACACAGAGGG + Intronic
960550408 3:118969970-118969992 GAGATACCTGTATGCGCAGAGGG - Intronic
960576335 3:119233466-119233488 GCAAAACCTGTGTATACAGAGGG + Intronic
964182055 3:153900419-153900441 GCAAAACCTGCATATACAAAGGG + Intergenic
971244853 4:24918193-24918215 GCAATTTCTGTGTACACAGTAGG - Intronic
971447074 4:26762452-26762474 CAAATACCTGTATACATTGAAGG - Intergenic
974075770 4:57166927-57166949 GCAAAACCGGTAGATACAGAGGG + Intergenic
979621350 4:122801803-122801825 GAAATACCTGATTTCACAGATGG + Intergenic
984715905 4:182924735-182924757 GCAATATCTGTATATACAGCAGG - Intergenic
986796596 5:11218748-11218770 GCAACACCTCTCTATACAGATGG - Intronic
989067253 5:37476472-37476494 GCAAAACTTGCATACACAAAAGG - Intronic
989275094 5:39579630-39579652 AAAATAACTGTAGACACAGAAGG + Intergenic
989512213 5:42301171-42301193 GCATTACATGTATAAGCAGAAGG + Intergenic
991253418 5:64588480-64588502 ACACTACCTGTACACACAGTGGG - Intronic
992551273 5:77862465-77862487 AGAAAACCTGTATACAGAGAGGG + Intronic
994479939 5:100321917-100321939 GGAAAACCTGTCTAAACAGATGG + Intergenic
994964226 5:106646495-106646517 GCAATACATGTAAATACAAAAGG - Intergenic
996165871 5:120222356-120222378 GGAATACTTGTGTCCACAGAGGG + Intergenic
997287959 5:132697291-132697313 CCAATTCCAGTATACAGAGATGG + Intronic
998423154 5:142005673-142005695 GCGATAGATGGATACACAGAAGG + Intronic
999691500 5:154149897-154149919 GCAAAACCTGTGGATACAGAGGG + Intronic
1000531835 5:162431906-162431928 GCAATACTTGTATGCAAGGAAGG - Intergenic
1004083661 6:12422195-12422217 GCAAAACCCTTATATACAGAGGG + Intergenic
1005030241 6:21501488-21501510 CCAATATCTGTATGCAAAGAAGG - Intergenic
1006192533 6:32218364-32218386 GCCATTCCTGTGTATACAGAGGG + Intronic
1013031119 6:106334186-106334208 TCTCTACCTGTCTACACAGATGG + Intergenic
1013289365 6:108707471-108707493 ACAATGCCTGTTTACACAGCAGG + Intergenic
1015941433 6:138456344-138456366 GCCATACCTGTAAACACAGGAGG - Intronic
1017426213 6:154323955-154323977 AAAATACATATATACACAGAGGG + Intronic
1023329393 7:39098703-39098725 GCAATACCTCCATGCAGAGATGG - Intronic
1031981417 7:128128808-128128830 GGAATATCTGCATACACAAAAGG + Intergenic
1033015872 7:137670932-137670954 GCTAGACCTGAATACGCAGATGG + Intronic
1041273795 8:56136582-56136604 GTAATACCTGGACACACATATGG + Intergenic
1043258900 8:78172739-78172761 GCAACACATGGACACACAGAGGG + Intergenic
1045716844 8:105056790-105056812 GCTAAACCTGCATACACAGATGG - Intronic
1046611562 8:116431305-116431327 GCAGAACCTGTGGACACAGAAGG - Intergenic
1048608407 8:135994836-135994858 GAAATACATGGATACAAAGATGG + Intergenic
1051064105 9:13081135-13081157 GAAATACCTGTACACATATACGG + Intergenic
1052238897 9:26248258-26248280 GCAAAACCTGTTTAGAAAGAAGG - Intergenic
1052565430 9:30143915-30143937 GCTGTACCTGCATACATAGAGGG - Intergenic
1056395068 9:86174438-86174460 GCAATACCTGTGTGTACATAGGG + Intergenic
1057736561 9:97667483-97667505 GACATACCTGTATACATATATGG + Intronic
1057988381 9:99741423-99741445 GCAATACCCTTATACACATAAGG - Intergenic
1059520402 9:114935302-114935324 GCCATAGATGTATACACAAAGGG - Intergenic
1059882846 9:118710841-118710863 GAAAAACCTGCATACATAGAAGG + Intergenic
1186433154 X:9521652-9521674 GCAAAACCCATAGACACAGAGGG - Intronic
1187489012 X:19732438-19732460 GCCAAACCTGTGTATACAGAGGG - Intronic
1189545845 X:42042045-42042067 GCCATTCCTCTATACACACATGG + Intergenic
1195457924 X:105090310-105090332 GCAAAACCTGTGTATACAGAGGG - Intronic
1195636006 X:107116924-107116946 TAAATACCTGTTTACACAGAAGG + Intronic
1197190592 X:123643128-123643150 GGAAAACCTGTACAAACAGAGGG + Intronic
1199176980 X:144800499-144800521 GTGAAACTTGTATACACAGAGGG - Intergenic