ID: 1113984561

View in Genome Browser
Species Human (GRCh38)
Location 13:114303483-114303505
Sequence CTGGTAAGAAGCAGAATTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113984557_1113984561 1 Left 1113984557 13:114303459-114303481 CCATCTGTGTATACAGGTATTGC 0: 1
1: 0
2: 0
3: 20
4: 120
Right 1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG 0: 1
1: 0
2: 4
3: 23
4: 204
1113984555_1113984561 8 Left 1113984555 13:114303452-114303474 CCATGCTCCATCTGTGTATACAG 0: 1
1: 0
2: 2
3: 18
4: 200
Right 1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG 0: 1
1: 0
2: 4
3: 23
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113984561 Original CRISPR CTGGTAAGAAGCAGAATTGT CGG Intronic
900269870 1:1781551-1781573 CGGGCAAGAAGCAGAATTGGTGG + Intergenic
900332566 1:2143430-2143452 CTGGAAAGAATCTGAATTGGAGG + Intronic
903107001 1:21089878-21089900 CTGGTAATAAGCACAATGGCAGG - Intronic
907038194 1:51235406-51235428 CTGATGAGAAGCAGAAAGGTTGG + Intergenic
907156002 1:52334515-52334537 GTTGTAAGCATCAGAATTGTTGG + Intronic
909162093 1:72165298-72165320 TTAGTAAGAAGCAAAATAGTTGG + Intronic
909744362 1:79075071-79075093 AAGCTAGGAAGCAGAATTGTAGG + Intergenic
912941697 1:114050844-114050866 CAGGTAATTAGCAGAAATGTAGG + Intergenic
916269628 1:162926720-162926742 CTGGGAAGAGATAGAATTGTTGG + Intergenic
917354196 1:174108950-174108972 CTGGTAAGAAAGAGGATTGTGGG + Intergenic
917477141 1:175378689-175378711 ATGGAAAGAAGCAGACTTGTGGG + Intronic
917496635 1:175546403-175546425 CAAGCAAGAAGCAGAATTGCCGG + Intronic
917691510 1:177474657-177474679 CTGGTAACAGCCAGAATTGAGGG - Intergenic
920102487 1:203526043-203526065 ATGGGAAGAAACAGAATTCTTGG + Intergenic
920839516 1:209542380-209542402 ATAGTAAGAAGCAGAATGATTGG - Intergenic
921665986 1:217871516-217871538 CTGGGAAGGAGCAGTATTGCTGG + Exonic
921739445 1:218667166-218667188 GTTCTTAGAAGCAGAATTGTGGG - Intergenic
922636351 1:227176339-227176361 ATGTTAAGAATCAGAATTCTTGG - Intronic
923526387 1:234776015-234776037 CTGATAAGAATCAGATTTCTAGG - Intergenic
923859427 1:237878155-237878177 CTGGTAACAAGAATAATGGTAGG - Exonic
1064313044 10:14228835-14228857 CTGTTCAAAAGCAGAATTCTAGG + Intronic
1064669256 10:17692489-17692511 CTGGTAACTGGCAGAATGGTTGG + Intronic
1065003719 10:21360960-21360982 CAGGAAAGAAGCAGATTTCTTGG - Intergenic
1067404048 10:46004254-46004276 ATGGAATGAAGCAGGATTGTTGG - Intergenic
1068303045 10:55170581-55170603 CTGGTAGAAAGCATAATTGATGG + Intronic
1070359621 10:75674749-75674771 CTGCAGAGTAGCAGAATTGTTGG + Intronic
1072559334 10:96556278-96556300 CAGGTAAGAGGCAGTATTGTTGG - Intronic
1072806705 10:98428082-98428104 CTGTTGAGAAGCAGAGTTCTGGG - Intronic
1073599072 10:104829262-104829284 CTGGTGAGTAGCAAAATTGGAGG + Intronic
1074021714 10:109591398-109591420 CTGTAAAGAGGCAGAATTGCTGG - Intergenic
1074080233 10:110162801-110162823 CTGTTCAGAAGCGGAAGTGTGGG + Intergenic
1074611894 10:115029678-115029700 CTGGTCAGATGTGGAATTGTGGG + Intergenic
1074666890 10:115737761-115737783 TTAGAAAGAAGCAGAATTGGGGG - Intronic
1075083713 10:119400414-119400436 CTTGTAATTGGCAGAATTGTGGG + Intronic
1076548659 10:131263050-131263072 CAGTTTAGAAGCACAATTGTTGG + Intronic
1080155962 11:29111403-29111425 TTGGGTAGAAACAGAATTGTAGG - Intergenic
1080574254 11:33583891-33583913 TTGGTAAGTAGCAGAACTGATGG + Intronic
1080769180 11:35324820-35324842 CTGGAAATAAGCAAATTTGTTGG - Intronic
1084944495 11:72631435-72631457 CTGGAGAGAAGCAGAAGTGGAGG - Intronic
1085171233 11:74451624-74451646 CTGGGAAGAAGTAGAATTTGTGG - Intergenic
1086527949 11:87751128-87751150 CTTGAAAGAAGTAGAGTTGTAGG + Intergenic
1086893639 11:92287557-92287579 CTGTCAAGAAGTAGAGTTGTAGG + Intergenic
1089976610 11:122737682-122737704 CTGGAGAGAAGCAAAATTGGCGG + Intronic
1090318172 11:125816504-125816526 CTGGTAATAAAGAGAATTCTGGG - Intergenic
1090438197 11:126704317-126704339 CTGGTAGGAAGCATGTTTGTCGG + Intronic
1090924027 11:131234058-131234080 GTGGTCAGAAGCAGAATGGCAGG - Intergenic
1091168814 11:133502746-133502768 CTCCTGAGAAGCAGAATAGTGGG - Intronic
1091194569 11:133720089-133720111 CTGGTAAGGAGGAGATTTGGAGG + Intergenic
1091249114 11:134127103-134127125 ATAGGAAGAAGAAGAATTGTAGG + Intronic
1091334077 11:134753674-134753696 CAGGTAAGGAGAAGGATTGTGGG - Intergenic
1093214176 12:16343835-16343857 GTATTTAGAAGCAGAATTGTTGG + Intergenic
1098363336 12:69676927-69676949 CTGCATAGAAGAAGAATTGTAGG + Exonic
1098798954 12:74928578-74928600 ATGTTCAGAAGTAGAATTGTTGG - Intergenic
1098990545 12:77060766-77060788 CTGGAAAGAAGGAGAGTTGTTGG - Intronic
1100368933 12:93947343-93947365 CTGATAAGAAGGAGATTAGTAGG - Intergenic
1101453444 12:104804195-104804217 CTGGTCAGCAGCAAAATTTTTGG + Exonic
1101511464 12:105396749-105396771 CTAATAAGAGGCAGAATTTTTGG + Intergenic
1105390330 13:19971131-19971153 CAGGTAAGGGGAAGAATTGTAGG + Intronic
1105395325 13:20028042-20028064 CTGGAATAAAGCAGAATTGTTGG - Intronic
1106744982 13:32692579-32692601 TTGGTAACAAGGAGATTTGTGGG + Intronic
1107063896 13:36191385-36191407 ATGGGAAGAAGCAGAGTAGTAGG + Intronic
1109255209 13:60071948-60071970 CTGATGGGAAGCAGAATTGGGGG - Intronic
1109719869 13:66261765-66261787 CTGGAAAGAGACAGACTTGTTGG - Intergenic
1110277982 13:73661072-73661094 GTGGGAGGAAACAGAATTGTGGG + Intergenic
1111261277 13:85743915-85743937 CTTGTAAGAAGAAAAATTGCTGG - Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114441936 14:22755594-22755616 CTTGTAAGAAGGAGAAATTTAGG + Intergenic
1118434162 14:65754232-65754254 CAGGTAAGATTCAGAACTGTAGG - Intergenic
1119191603 14:72686431-72686453 CAACTAAGAAGCAGAAGTGTAGG + Intronic
1122024760 14:98867688-98867710 CTGGAAAGAATCAGATTTGCAGG - Intergenic
1123909338 15:24951182-24951204 CTGCTTAGGAGTAGAATTGTAGG + Intronic
1124156714 15:27232623-27232645 ATGATTAAAAGCAGAATTGTAGG - Intronic
1129534438 15:76300580-76300602 TTGGTAGGAAGCAGAATTGTAGG - Intronic
1131086875 15:89583357-89583379 CTGGTAACAAGCATCATTCTGGG - Intronic
1132211446 15:100026085-100026107 ATGGTAGGAGTCAGAATTGTTGG - Intronic
1132221840 15:100110945-100110967 CTGGTGAGAAGCAGACTTCGTGG - Intronic
1133727510 16:8551152-8551174 CTGGTAAAAACCAGAATTCTAGG - Intergenic
1135276986 16:21121734-21121756 CTTGTTAGAAGCACAATTCTGGG + Intronic
1141000456 16:80302712-80302734 GAGGTGAGAGGCAGAATTGTGGG - Intergenic
1143802160 17:9392286-9392308 TTGCTAAGAAGCATAGTTGTTGG + Intronic
1143912767 17:10265568-10265590 ATGGTTAGAAGCAGAATTGGGGG - Intergenic
1144286669 17:13782126-13782148 ATGATTAGAAGCAGAATTTTTGG - Intergenic
1145846000 17:28039945-28039967 CTGGGAAGTAGCAGAAGTGAGGG + Intergenic
1150047409 17:61927271-61927293 CGGGTAAAAAGCAGATGTGTGGG + Intronic
1152061571 17:78079798-78079820 CTGGTCAGAAGCAATATTGAGGG + Intronic
1152160915 17:78668150-78668172 CTGGTGAGTAGCAGAGTTGATGG - Intergenic
1153330999 18:3874506-3874528 CTTTTAAAAAGCAGAATTCTTGG - Intronic
1155061281 18:22231104-22231126 CTGGTAAGCAGGAGAATTGCTGG + Intergenic
1157448948 18:47771422-47771444 CTGGTCAGAAATAGAATTGTTGG - Intergenic
1157794645 18:50562093-50562115 CTGCTCAAAAGCAGAATTCTAGG - Intronic
1158227882 18:55219261-55219283 CTGTAAAGAAGTAGACTTGTAGG - Intergenic
1158590286 18:58773293-58773315 CTGGGAAATAGCAGAATAGTGGG - Intergenic
1159069220 18:63604907-63604929 CTGGTCAGAAGCAGAAGAGCTGG - Intergenic
1159084817 18:63776609-63776631 CTGGTATGAAGCATAGTTTTTGG + Intronic
1164138905 19:22439960-22439982 CTGTAAAAAAGCAGAACTGTGGG - Intronic
1164310981 19:24046048-24046070 CTGGTAGGAAACAGTATTTTGGG + Intronic
1166038792 19:40190100-40190122 CTTGTAAGAGGCAAAATTCTGGG - Intergenic
1167647979 19:50716084-50716106 CTGGTCAGAAGCAGAACAGATGG + Intronic
927338793 2:21956309-21956331 CTTTTAAGAAGCAGAATTAGAGG - Intergenic
928294360 2:30069962-30069984 GTGGTAAAGAGCAGATTTGTGGG + Intergenic
928299927 2:30116099-30116121 CAGGTAAAAACCAGAATGGTTGG - Intergenic
929748321 2:44682872-44682894 CTGGTAATCAAAAGAATTGTTGG + Intronic
929872131 2:45768040-45768062 CTGGTGAGAAGCAAAATTGTTGG + Intronic
931341740 2:61408543-61408565 CTGTTAATCAGAAGAATTGTAGG - Intronic
932323145 2:70836572-70836594 CTGGTGAGGAGCAGACTGGTGGG + Intergenic
933591138 2:84233862-84233884 ATGGGAAGAATCAGAATTCTGGG - Intergenic
934764094 2:96870557-96870579 CTAGAAAGAGGCAGAATTGGGGG - Intronic
936111827 2:109671135-109671157 CTGGTAGGAAGCAGCAGTGTGGG - Intergenic
936834030 2:116684907-116684929 CTGTTAGGAATCAGAATTTTGGG - Intergenic
938191951 2:129291456-129291478 TAGGCAAGAAGCAGAACTGTGGG + Intergenic
938659617 2:133472177-133472199 ATGGAAACAAGCAGAATTTTAGG - Intronic
940727897 2:157356014-157356036 CTAGTCAGAAGCAGAACAGTTGG - Intergenic
940976967 2:159957213-159957235 CTGGGAAGAAGTAGAAATGAAGG + Intronic
942272062 2:174286382-174286404 CTGGTGAGCAGCTGAATTCTAGG + Intergenic
943631161 2:190253957-190253979 CTGGAAAGAAGCAGAATTGGGGG - Intronic
945594129 2:211770701-211770723 CTAGTATGGAGCAGACTTGTTGG - Intronic
945742912 2:213685301-213685323 CTTGTAAGAAGGAGAAAGGTGGG + Intronic
945850400 2:214999314-214999336 CTAGTATAAAGCAGAAATGTTGG + Intronic
947292253 2:228588930-228588952 GTGTCCAGAAGCAGAATTGTTGG + Intergenic
1169905455 20:10598750-10598772 CTGGTAAGAAGCCGATTTCTTGG + Exonic
1170146834 20:13184724-13184746 ATGGCAAAAAGCAGAAGTGTGGG - Intergenic
1172439345 20:34954785-34954807 CAGAGAAGAAGCAGATTTGTGGG - Intronic
1172586814 20:36091493-36091515 CAGTGAAGAACCAGAATTGTTGG + Intronic
1172931561 20:38589759-38589781 CTGGATAGAAGCACACTTGTGGG - Intergenic
1172992398 20:39046294-39046316 CTGGTAGGAGGCAGAAATCTGGG + Intergenic
1173103329 20:40107841-40107863 CAGCCAAGAAGCAGCATTGTAGG - Intergenic
1174332256 20:49829736-49829758 CTTGTCATCAGCAGAATTGTGGG - Intronic
1174716122 20:52760903-52760925 CTGGTCAGAGGGAGAATTGGTGG + Intergenic
1176984412 21:15419879-15419901 CTCGTAAGAAGCAGCAGTCTAGG + Intergenic
1180933762 22:19610776-19610798 CTGCTAAGGAGCAGAAGTGGGGG - Intergenic
1182750393 22:32637143-32637165 CTGGTAAGATTTAGAATTGCAGG - Intronic
950197493 3:11019128-11019150 CTACTCAGAAGCAGAATTGCTGG - Intronic
951052807 3:18113657-18113679 CTGTCAAGATACAGAATTGTGGG - Intronic
951657190 3:25022792-25022814 GTGGCAAGAAGCAGCATGGTGGG + Intergenic
955417064 3:58702343-58702365 TTGGTAAGTAGCAGAAGTGCAGG + Intergenic
955537356 3:59938434-59938456 ATAGTAAGCAGCAGATTTGTAGG + Intronic
957734318 3:84187414-84187436 GTGGTAAGAGGCAATATTGTGGG + Intergenic
957849179 3:85783369-85783391 CAAATAAGAAGCAGAAGTGTTGG - Intronic
958034298 3:88151553-88151575 CTTGTTAGAAGCAGAATTTCTGG - Intronic
958896708 3:99837668-99837690 CAGGTCAGAAGGAGAAGTGTTGG - Intronic
959531069 3:107434007-107434029 TTGATGAGAGGCAGAATTGTGGG - Intergenic
960504211 3:118473193-118473215 GTGGTCAGAATTAGAATTGTTGG - Intergenic
960737503 3:120796823-120796845 CAGGAAAGAAGCAGAATGCTTGG - Intergenic
960803990 3:121565095-121565117 CTGGTAACAAGCACTATTCTGGG - Intergenic
961344605 3:126255895-126255917 CTGGTAAGTAGCAGAACAGTGGG - Intergenic
963138543 3:141929475-141929497 CTGTTAGGAAGCAGAATCTTGGG - Intergenic
963211555 3:142698157-142698179 TTGGTCTGAATCAGAATTGTGGG - Intronic
964211477 3:154233129-154233151 CTGGTAAGAAACCCAATTCTAGG - Intronic
967576004 3:191093934-191093956 CTGGGAAGAAACAGAAATGGTGG - Intergenic
968839034 4:2987638-2987660 GTACTCAGAAGCAGAATTGTTGG + Intronic
969926956 4:10594105-10594127 CTGGTGGGAAGCAGAAGAGTGGG - Intronic
970632074 4:17958232-17958254 CAGGAAAAAAACAGAATTGTGGG + Intronic
973140579 4:46763505-46763527 ATGGTCAGAAGCAGAATGGGAGG - Intronic
973321327 4:48813277-48813299 CTTGTAAGAATCAGTATTGTGGG + Intronic
974318267 4:60310142-60310164 CCAGTAAGAGGCAGAACTGTTGG - Intergenic
976146794 4:82049949-82049971 CTGGGAGGAGGGAGAATTGTAGG - Intergenic
980708910 4:136538684-136538706 ATAGTAAAAAGCAGAATTCTAGG + Intergenic
986299770 5:6468690-6468712 CTCCTAAGAAGTAGAATTGAAGG - Intronic
986875766 5:12106769-12106791 CAGGTTAAAAGCAGAATTCTGGG + Intergenic
987077082 5:14393544-14393566 CTGGTAAGAAGCATAATCAAAGG - Intronic
988660832 5:33266415-33266437 CTGGTAAGAGACAGAATTGTAGG + Intergenic
990115564 5:52386019-52386041 CTGGAAAGAAGGAGAATAGCAGG + Intergenic
990203045 5:53399184-53399206 GTGGTCAGAAGGAGAATTGAGGG + Intergenic
991019487 5:61964967-61964989 CTTGAAAGAAGCAGAAGTGGTGG + Intergenic
991460917 5:66857417-66857439 ATGCCAAGAAGCAGAATTGCTGG + Intronic
994621902 5:102173422-102173444 CAGTGAAGAAGCAGAAATGTAGG + Intergenic
997781687 5:136666101-136666123 TTAGGAAGAAGTAGAATTGTGGG + Intergenic
998538445 5:142956070-142956092 TTGGTATTAAGCATAATTGTGGG + Intronic
998792791 5:145783510-145783532 CTGTTAAAAATCAGAATTCTTGG + Intronic
1000686439 5:164255333-164255355 CTGGTAGGTAGGAGCATTGTAGG + Intergenic
1001711889 5:173785687-173785709 CTGGTAAGAAGCTAAAGTGATGG - Intergenic
1001852783 5:174984123-174984145 TTGTAAAGAAGCAGCATTGTAGG - Intergenic
1002880031 6:1242970-1242992 CTGGGAAGAAGCAGAGCTGGAGG + Intergenic
1004987850 6:21102856-21102878 CTGGCAGGAAGCAGAAAGGTAGG - Intronic
1008247965 6:49202561-49202583 TTGGTGAGGAGCAGAATTCTAGG + Intergenic
1009533406 6:64850027-64850049 CCTGTAATAAGCAAAATTGTAGG - Intronic
1009591228 6:65673330-65673352 GTGGTAAGAGGCAATATTGTGGG + Intronic
1010497654 6:76554736-76554758 CTGCTATGAAGCAGAAATGTGGG - Intergenic
1011716409 6:90109663-90109685 CTGGAAAGAAGCAGGTTTGGAGG - Intronic
1012621169 6:101345692-101345714 ATGCATAGAAGCAGAATTGTTGG - Intergenic
1013675850 6:112461750-112461772 CTGGTAAATAGCAGAATAGTGGG + Intergenic
1014441719 6:121480941-121480963 CTGCTAAGAAGCAGATTTGGGGG - Intergenic
1018028833 6:159826285-159826307 CTGGAGAGAAGCTGCATTGTAGG - Intergenic
1021884456 7:25125151-25125173 CTGGTTAGAGGCAGAGCTGTGGG - Intronic
1022119175 7:27290662-27290684 ATGGTAAGAAGCAGATTTGGTGG + Intergenic
1022497681 7:30863271-30863293 CTGGAGAGAAGCAGAGTGGTGGG + Intronic
1023114242 7:36845825-36845847 CTGGTATGCAGAAGAATTGATGG + Intergenic
1025243269 7:57295808-57295830 CTGGGTAGAAGCAGGATTGCTGG + Intergenic
1026396580 7:69961209-69961231 CTGGTAAGGATCAGATCTGTTGG + Intronic
1027638365 7:80703673-80703695 TGGGTAAGAAGCAGCATGGTGGG - Intergenic
1028154633 7:87415908-87415930 GTGGAAAGAAGCAGGATTGAGGG + Intronic
1028453809 7:91016622-91016644 CAGGTCTTAAGCAGAATTGTAGG + Intronic
1032646819 7:133834099-133834121 CTTATTTGAAGCAGAATTGTGGG + Intronic
1034787992 7:153942795-153942817 CAGGGAAGAGGCAGAATGGTAGG - Intronic
1034845712 7:154442803-154442825 CTGGGAAGTAGCTGAATTCTGGG - Intronic
1036186879 8:6629875-6629897 TTGGTAAGAAGCAGGATCTTAGG + Intronic
1036733817 8:11289308-11289330 CTAGTAAGAGGCAGAACTGAAGG - Intronic
1040891535 8:52322242-52322264 GTGGTAAAAATGAGAATTGTAGG - Intronic
1041872488 8:62650665-62650687 CTGGTGATAATCAGAAATGTAGG - Intronic
1046564097 8:115876492-115876514 CTTGGAAGAAGCAGAGTTGTTGG - Intergenic
1046900324 8:119516707-119516729 TTGGTAAGAAACAATATTGTTGG + Intergenic
1048395398 8:134009763-134009785 CTGTCAGGAAGCAGAATCGTTGG - Intergenic
1050141779 9:2523598-2523620 CTGCTTAGAACCAGAATTTTTGG - Intergenic
1050822346 9:9895229-9895251 CTGGTAACAAACAGAATTCCTGG - Intronic
1052710989 9:32055225-32055247 ATTGTAAAAAGCAGAATTTTAGG - Intergenic
1053054289 9:34985072-34985094 CTGGAGAGAAGCAGATTTGAAGG + Intergenic
1055154709 9:73046144-73046166 ATGCTAAGAAGCAGAATTTCTGG + Intronic
1055574895 9:77650883-77650905 CTGGTAAGAAACAGAAAACTGGG + Intergenic
1056247687 9:84712989-84713011 ACAGAAAGAAGCAGAATTGTTGG + Intronic
1056888750 9:90469619-90469641 GTGGTGAGCAGCAGAAATGTCGG + Intergenic
1057706240 9:97396945-97396967 CTGGTAAGAAAAAGAAGGGTTGG - Intergenic
1057894221 9:98894203-98894225 ATGGGAAAAAGCAGCATTGTCGG - Intergenic
1060133363 9:121127330-121127352 ATGCTCAGAAGCAGAACTGTGGG + Intronic
1185588410 X:1257565-1257587 CTGTGTAGAAGCAGAATTGGTGG - Intergenic
1186391783 X:9167826-9167848 CTGGGAAAAGGCAGAATTGAAGG + Intergenic
1186720388 X:12297502-12297524 GTGGGAAAAAACAGAATTGTGGG + Intronic
1187398072 X:18935170-18935192 ATGGTTAGAAGAAGAATTCTTGG - Intronic
1189000607 X:36940412-36940434 CTGGAAAGAAGTAGAGTGGTGGG - Intergenic
1190356218 X:49607962-49607984 CCAGTAAGAAGCAGATTTGGGGG + Exonic
1190480796 X:50874861-50874883 CTTGAAAGTAGCAGAAATGTAGG - Intergenic
1192269190 X:69562777-69562799 TTGGTAAGCAGCAGAACTTTGGG - Intergenic
1192556130 X:72091114-72091136 CTGGAAAGAAGTGGAATTGTTGG + Intergenic
1192632615 X:72789150-72789172 GTGTGAAGAGGCAGAATTGTGGG + Intronic
1192649094 X:72931651-72931673 GTGTGAAGAGGCAGAATTGTGGG - Intronic
1195501091 X:105600763-105600785 CTACTAAGAAGTAGAATTGCTGG + Intronic
1196895520 X:120331832-120331854 CGGGTCTGTAGCAGAATTGTGGG + Intergenic
1197629168 X:128838021-128838043 CTAGTATGAAGTAGAATAGTAGG - Intergenic
1198279019 X:135124097-135124119 CTGGCTAGAAGTAGAATTGTAGG - Intergenic
1198291939 X:135248423-135248445 CTGGCTAGAAGTAGAATTGTAGG + Intergenic
1198297972 X:135305402-135305424 CTGGCTAGAAGTAGAATTGTAGG + Intronic
1200088463 X:153623398-153623420 CTGGCAGGAAGCAGAGTGGTGGG - Intergenic
1202098666 Y:21281871-21281893 CTGGAAAGATGCAGAATTCCTGG + Intergenic