ID: 1113984562

View in Genome Browser
Species Human (GRCh38)
Location 13:114303488-114303510
Sequence AAGAAGCAGAATTGTCGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 1, 2: 5, 3: 23, 4: 251}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113984555_1113984562 13 Left 1113984555 13:114303452-114303474 CCATGCTCCATCTGTGTATACAG 0: 1
1: 0
2: 2
3: 18
4: 200
Right 1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG 0: 1
1: 1
2: 5
3: 23
4: 251
1113984557_1113984562 6 Left 1113984557 13:114303459-114303481 CCATCTGTGTATACAGGTATTGC 0: 1
1: 0
2: 0
3: 20
4: 120
Right 1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG 0: 1
1: 1
2: 5
3: 23
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113984562 Original CRISPR AAGAAGCAGAATTGTCGGCC CGG Intronic
900265495 1:1755112-1755134 AAGGCACAGAAGTGTCGGCCGGG - Intronic
900604535 1:3517983-3518005 AAGGGGCAGAAATGTCGGGCCGG - Intronic
900860514 1:5226036-5226058 AAGAATTAGAATTGAAGGCCAGG - Intergenic
901544825 1:9948277-9948299 AAGAAATGGAGTTGTCGGCCAGG + Intronic
902150230 1:14436981-14437003 AAGAAGCTGAAGTGTCAGGCAGG - Intergenic
903805425 1:26002021-26002043 AAGAAAAAGAATTTTAGGCCGGG + Intergenic
905163331 1:36057033-36057055 AAGAAAAAGAATAGTAGGCCGGG - Exonic
905593654 1:39186903-39186925 AAGAAACAGAAATGTGGCCCAGG - Intronic
906069525 1:43007100-43007122 AAAAAGCAGTCTTGTCGGCCGGG - Intergenic
906281172 1:44554916-44554938 AGGAATCAGAATTGTGGGCAGGG - Intronic
908125877 1:61029835-61029857 AAGAAGAAGAAGTATGGGCCAGG + Intronic
909853200 1:80495584-80495606 AAAAAGCAGATTTTTGGGCCGGG - Intergenic
911000278 1:93157827-93157849 AAAAAACAGATTTGTAGGCCGGG + Intronic
911143801 1:94533397-94533419 AAGAAGCAGGCGTGGCGGCCTGG + Intronic
912690679 1:111802444-111802466 AAGATGCAGACTTGCAGGCCAGG - Intronic
913975934 1:143455438-143455460 AAGAAGCAGAATGGGAGGCAGGG + Intergenic
914070330 1:144281060-144281082 AAGAAGCAGAATGGGAGGCCGGG + Intergenic
914108825 1:144685294-144685316 AAGAAGCAGAATGGGAGGCCGGG - Intergenic
916093260 1:161325903-161325925 AGAAAGCAGAGTTATCGGCCTGG + Intronic
917402812 1:174669807-174669829 AAGAAACAGAATAGAGGGCCTGG - Intronic
917477142 1:175378694-175378716 AAGAAGCAGACTTGTGGGCCTGG + Intronic
919843390 1:201625621-201625643 AAGAAGCAGAAATGCAGGGCAGG + Intronic
920577039 1:207069038-207069060 AAGAAAAAGAAATGTCGGCCGGG - Intronic
921348042 1:214207318-214207340 AAGAAGCAGAGTTGGGGTCCAGG + Intergenic
921350762 1:214232149-214232171 AAGAAGCAGAGATGTTGGCCCGG + Intergenic
922991037 1:229911717-229911739 AAGAGGGAGAAATGTCAGCCAGG - Intergenic
1064134017 10:12735179-12735201 AAGAAACGAAAGTGTCGGCCGGG + Intronic
1065047936 10:21760878-21760900 AAGAGGCAGTATTTTAGGCCAGG + Intronic
1069069978 10:63983164-63983186 AAGAAGTTGTATTGTGGGCCGGG + Intergenic
1070199015 10:74185535-74185557 TTGAAGCAGAGTCGTCGGCCGGG + Intronic
1070623496 10:78032168-78032190 AAAAAGAAAAATAGTCGGCCGGG + Intergenic
1070825951 10:79390798-79390820 AGGAAGCAGATGTGGCGGCCAGG + Intronic
1071556243 10:86604130-86604152 AGGAAGCAGAAATGTAGGCGAGG - Intergenic
1073274386 10:102296747-102296769 AAAAAAAAGAATTGTAGGCCAGG + Intronic
1073963441 10:108960677-108960699 AAAAATCAGAATTTTTGGCCAGG + Intergenic
1076504584 10:130963360-130963382 TAGAAGATGAATTGTCGGCAGGG + Intergenic
1077062281 11:623011-623033 AAGAAACTGGATTGTCAGCCGGG + Intronic
1077527116 11:3073703-3073725 AAGAAGAAGGATCGTTGGCCAGG - Intergenic
1078921515 11:15835242-15835264 AAGAAGGAGAAGTCTGGGCCGGG - Intergenic
1081684573 11:45033157-45033179 CAGCAGCAGAATTGTTGACCAGG + Intergenic
1082127184 11:48447188-48447210 AAAAAGAAAACTTGTCGGCCAGG - Intergenic
1083735689 11:64679340-64679362 AAGAATCAGGATTGAGGGCCAGG + Intronic
1085089579 11:73699146-73699168 AAAAAACAGCATTATCGGCCTGG - Intronic
1087544285 11:99564381-99564403 TATAAACAGAATTGTTGGCCAGG - Intronic
1088025786 11:105180763-105180785 AGAAATCAGGATTGTCGGCCGGG + Intergenic
1088311056 11:108461018-108461040 AAAAAGCAGACTTTTTGGCCGGG - Intronic
1089195524 11:116692178-116692200 AAGAAGCAGGATTCTGGCCCTGG + Intergenic
1091025919 11:132141166-132141188 AAGAAGCAAAAGTGTCTGCTTGG - Intronic
1091973948 12:4810249-4810271 AAGAAGCGGACTCGCCGGCCAGG - Exonic
1096699102 12:53370770-53370792 AAGAAGTAGAATTGTAGTCAGGG + Intergenic
1097244284 12:57598223-57598245 AAGAATCCAAATTGTAGGCCGGG + Intronic
1097864511 12:64548483-64548505 AAGAAGTAAAATTGTTGGCCAGG - Intergenic
1098190737 12:67945725-67945747 AAGAAGCTGGATTTTTGGCCGGG - Intergenic
1099403422 12:82228604-82228626 AGGAAAAAGAATTGTTGGCCGGG + Intronic
1101926402 12:108975442-108975464 AAGAGGCAGAATTGAAAGCCAGG - Intronic
1101993446 12:109506644-109506666 AAGAAACAGATTTGGCAGCCCGG - Intronic
1102639121 12:114350935-114350957 AAGAAACACATTTGTGGGCCAGG - Intergenic
1103124468 12:118409438-118409460 AAGAAACAGAATTTTAGGCCGGG - Intronic
1103479807 12:121243837-121243859 AAGAAACAGAAGTGACTGCCTGG + Intronic
1103818614 12:123679090-123679112 AGAAAGCTGAATTATCGGCCAGG - Intronic
1104457238 12:128924989-128925011 AAGAAGCAGCATTGTTTCCCAGG - Intronic
1105214011 13:18273960-18273982 AAGAGACAGACTTGTCTGCCTGG + Intergenic
1105721759 13:23123661-23123683 TAGAAACAGAAGTGTAGGCCAGG - Intergenic
1106326919 13:28700596-28700618 TAGAGGCAGAATTCTCAGCCAGG + Intronic
1106472501 13:30069965-30069987 AAGATGCAGACATGACGGCCAGG + Intergenic
1106740550 13:32636062-32636084 AAGAATCAGAATACTAGGCCGGG - Intronic
1107112348 13:36711666-36711688 TAAAAGAAGAATTGTAGGCCAGG - Intergenic
1108431965 13:50362246-50362268 AAGAAGAAGACCTCTCGGCCAGG - Intronic
1109208693 13:59509898-59509920 AAGATATAGAGTTGTCGGCCGGG + Intergenic
1109295421 13:60524801-60524823 AAAAAACACAATTTTCGGCCAGG + Intronic
1110343788 13:74422952-74422974 AAGAATCAGATTTGTCAGCCTGG - Intergenic
1111437027 13:88224487-88224509 AAAAAACAGAACTGTGGGCCTGG - Intergenic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1116913674 14:50499360-50499382 TAGAAGCAGTATTGGGGGCCAGG + Intronic
1119600733 14:75974789-75974811 AAGAAGAAGAATTGGCAGCCAGG + Intronic
1119632376 14:76244227-76244249 AAGAACCAGAGTTCTTGGCCAGG + Intronic
1121433905 14:93906331-93906353 AGGATGCAGAATAGTTGGCCAGG - Intergenic
1122464815 14:101924735-101924757 AAGAAGCAGAAATTTCTGGCTGG - Intronic
1125530489 15:40410128-40410150 AAGAAGCAGGACTGGAGGCCAGG - Intronic
1125933878 15:43618213-43618235 AGGAAGAAGAAATGTTGGCCAGG + Exonic
1125946975 15:43717675-43717697 AGGAAGAAGAAATGTTGGCCAGG + Intergenic
1126590549 15:50335601-50335623 AAAAAGAAGACTGGTCGGCCGGG + Intronic
1129131869 15:73505825-73505847 AAGAAGGAGAAGTGCAGGCCGGG - Intronic
1129454264 15:75668111-75668133 AATAATAAGAATGGTCGGCCTGG + Intergenic
1129494729 15:75967755-75967777 AAGAATCAGATTTTGCGGCCAGG - Intronic
1129553651 15:76481024-76481046 AAAAAGTAGAATAGTGGGCCGGG - Intronic
1130533378 15:84765094-84765116 AAGAAGTAGAATTGGTTGCCAGG - Intronic
1130793871 15:87187969-87187991 AAGAAGAAAAAATGTGGGCCAGG + Intergenic
1131624327 15:94101596-94101618 AAGAAACTTACTTGTCGGCCGGG + Intergenic
1132160776 15:99539813-99539835 AAAAAGCAAAAATATCGGCCGGG + Intergenic
1135512637 16:23100475-23100497 ACAAAGCAGAATAGTGGGCCGGG + Intronic
1138316488 16:56074287-56074309 AAGAAGCAGAGTTATTGGCTGGG - Intergenic
1140130456 16:72156321-72156343 AAGAATCAGTATTGGAGGCCGGG + Intronic
1140358732 16:74327397-74327419 AAAAAATAGAATTATCGGCCGGG + Intergenic
1140863037 16:79035888-79035910 AAGAAGCTGAATTCTTGGCTGGG - Intronic
1143018937 17:3906424-3906446 AAGAAGTACCATTGTTGGCCGGG - Intronic
1143244008 17:5468124-5468146 AAGAGGCAGAGTTGTGGGGCAGG - Intronic
1144478818 17:15612209-15612231 AAGAAGAGGAAGTGTCGGGCTGG + Intronic
1144983543 17:19185083-19185105 AAAAACCAGAAATGTAGGCCGGG + Intergenic
1144984682 17:19193156-19193178 AAAAACCAGAAATGTAGGCCGGG - Intergenic
1145292233 17:21557221-21557243 AAAAAAAAGAATTGTAGGCCAGG + Intronic
1148554515 17:48570345-48570367 TAGAATCAGAGTTCTCGGCCGGG + Intronic
1151224722 17:72639990-72640012 GAGAAGCACAATTGTGGGCTGGG + Intergenic
1151331271 17:73410610-73410632 AAGAAGCAGCATTATCGGCCGGG - Intronic
1152444472 17:80333353-80333375 AAGAAGCAGAAGACTCAGCCGGG - Intronic
1153622471 18:6991683-6991705 AAGAAGTAGAATTATTGGCTGGG - Intronic
1155557022 18:27031197-27031219 AAGAAGCAGAATTGAAGTTCAGG - Intronic
1157467987 18:47964819-47964841 GAGAAGGAAAATTGTCAGCCTGG - Intergenic
1158364613 18:56719266-56719288 AAAAAACAGAATTGCTGGCCGGG + Intronic
1158595024 18:58808426-58808448 AAGAAGCAAAACGGTAGGCCGGG - Intergenic
1159814446 18:73055195-73055217 AAGAGACAGAGTTTTCGGCCGGG - Intergenic
1161099117 19:2411845-2411867 AAAAATTATAATTGTCGGCCGGG - Intronic
1164900153 19:31912424-31912446 ATGAAGGAGAATTGTCTACCTGG - Intergenic
1165048019 19:33121612-33121634 AAAAAGGAGACTTGGCGGCCGGG - Intronic
1165719394 19:38068322-38068344 AAGAATCTGATTTTTCGGCCGGG - Intronic
1166398721 19:42462042-42462064 AAGAAGCAGAATTGTGGGCCAGG + Intergenic
1166816064 19:45546962-45546984 AAGAAGCAGAGTTTTAGGCCAGG - Intronic
1167181123 19:47904245-47904267 AAGAAGCAAAGTGGACGGCCGGG + Intergenic
1167181791 19:47909605-47909627 AAGAAGCAAAGTGGACGGCCGGG + Intergenic
1167182440 19:47914995-47915017 AAGAAGCAAAGTGGACGGCCGGG + Intergenic
1167183108 19:47920347-47920369 AAGAAGCAAAGTGGACGGCCGGG + Intergenic
1167183776 19:47925697-47925719 AAGAAGCAAAGTGGACGGCCGGG + Intergenic
1167184405 19:47930747-47930769 AAGAAGCAAAGTGGACGGCCGGG + Intergenic
1167185077 19:47936098-47936120 AAGAAGCAAAGTGGACGGCCGGG + Intergenic
1167185730 19:47941487-47941509 AAGAAGCAAAGTGGACGGCCGGG + Intergenic
1167186397 19:47946842-47946864 AAGAAGCAAAGTGGACGGCCGGG + Intergenic
1167187048 19:47952233-47952255 AAGAAGCAAAGTGGACGGCCGGG + Intergenic
1167187698 19:47957616-47957638 AAGAAGCAAAGTGGACGGCCGGG + Intergenic
1167303157 19:48691320-48691342 AAGAAAAAAAATTGTAGGCCGGG - Intergenic
1167480073 19:49724737-49724759 AAGAAACATCATTGTTGGCCGGG - Intergenic
1167542143 19:50096016-50096038 AAGAAGCAAAGTGGACGGCCGGG - Intergenic
1167542578 19:50099081-50099103 AAGAAGCAAAGTGGACGGCCGGG - Intergenic
1167543015 19:50102146-50102168 AAGAAGCAAAGTGGACGGCCGGG - Intergenic
1167543451 19:50105209-50105231 AAGAAGCAAAGTGGACGGCCGGG - Intergenic
1167544124 19:50110553-50110575 AAGAAGCAAAGTGGACGGCCGGG - Intergenic
1167544799 19:50115906-50115928 AAGAAGCAAAGTGGACGGCCGGG - Intergenic
1167545474 19:50121258-50121280 AAGAAGCAAAGTGGACGGCCGGG - Intergenic
1167546151 19:50126613-50126635 AAGAAGCAAAGTGGACGGCCGGG - Intergenic
1167546828 19:50131948-50131970 AAGAAGCAAAGTGGACGGCCGGG - Intergenic
1167547486 19:50137321-50137343 AAGAAGCAAAGTGGACGGCCGGG - Intergenic
1168143726 19:54407179-54407201 TAAAAGTAGAATTGTTGGCCGGG + Intergenic
925076038 2:1016534-1016556 AAGAAATAAAGTTGTCGGCCGGG - Intronic
925203384 2:1987154-1987176 AAGAATCAGAATTTTAGGGCTGG + Intronic
929527138 2:42715181-42715203 AAGTGGCAGCATTGTTGGCCTGG + Intronic
929872132 2:45768045-45768067 GAGAAGCAAAATTGTTGGCCAGG + Intronic
930811801 2:55549935-55549957 AAGAAGAAGAATCGTCCCCCAGG - Exonic
931654952 2:64502470-64502492 AAAAAACAAAATTGTGGGCCGGG + Intergenic
932741798 2:74296465-74296487 AAGAAAGCCAATTGTCGGCCAGG + Intronic
933929305 2:87132096-87132118 AAGAAGCAGACTTGTAGTCTTGG + Intergenic
934000634 2:87707889-87707911 AAGAAGCAGACTTGTAGTCTTGG + Intergenic
934180632 2:89616420-89616442 AAGAAGCAGAATGGGAGGCAGGG + Intergenic
934290932 2:91690679-91690701 AAGAAGCAGAATGGGAGGCAGGG + Intergenic
934300312 2:91772789-91772811 AAGAAACAGACTTGTCTGCCTGG - Intergenic
934718376 2:96556168-96556190 AAAAACCAGAATTTTTGGCCAGG + Intergenic
935391947 2:102562129-102562151 AAGAAGCAGAAATGTGAGCTTGG + Intergenic
935417194 2:102831459-102831481 AAGAAGAAGAGTGGTGGGCCAGG + Intronic
935883403 2:107590049-107590071 AAAAAGCAAAATTTTCAGCCGGG + Intergenic
936363635 2:111831285-111831307 AAGAAGCAGACTTGTAGTCTTGG - Exonic
937058654 2:118964498-118964520 AAAAAGAAGAATTGTCAACCAGG - Intronic
937466672 2:122138990-122139012 ATGAAGTAGAATTGTGGGCCTGG - Intergenic
937853172 2:126654369-126654391 AAGAAGCAGAAAGTTCTGCCAGG - Intergenic
938659615 2:133472172-133472194 AACAAGCAGAATTTTAGGGCAGG - Intronic
941171325 2:162140840-162140862 AAGAAGAAGAAATGTAGGCAAGG - Intergenic
943631159 2:190253952-190253974 AAGAAGCAGAATTGGGGGAAGGG - Intronic
944300495 2:198119448-198119470 AAGAAACAGAACTGAGGGCCTGG - Intronic
944349872 2:198714215-198714237 AATAAGCGTAATTCTCGGCCAGG + Intergenic
944546353 2:200802733-200802755 AAGAAGTGGAATTGCCGGCCAGG - Intergenic
944559195 2:200918202-200918224 TAGAAGCAGCATTGGCAGCCAGG - Intronic
944908392 2:204285427-204285449 AGGAAGCAGAAGTGGGGGCCTGG + Intergenic
949005501 2:241644573-241644595 AGGAATCAGAAGTGTTGGCCGGG + Intronic
1170078964 20:12450563-12450585 AAGAAGTGGGTTTGTCGGCCAGG + Intergenic
1171126371 20:22605434-22605456 AAGAAACAGGATTTTGGGCCTGG - Intergenic
1172414228 20:34751073-34751095 AAGAATGTGAAGTGTCGGCCGGG + Intronic
1172542289 20:35728080-35728102 AAAAATAAGAATTGTAGGCCAGG - Intronic
1173685558 20:44921107-44921129 AAGAAACAAAATTGATGGCCAGG - Intronic
1175058077 20:56216388-56216410 AAGAAATAGAATTTTCAGCCAGG + Intergenic
1177137697 21:17323933-17323955 AAGAATCAGTATTGTTGGCTGGG + Intergenic
1177238070 21:18419518-18419540 AAAAAGAGGAAATGTCGGCCGGG - Intronic
1177431472 21:20997161-20997183 AAGAGGCAGAATCACCGGCCCGG - Intergenic
1177484993 21:21745799-21745821 AAAAAGCAGTTTTGTGGGCCGGG + Intergenic
1177703204 21:24665278-24665300 AAGAAGAAGAATTTTCTCCCAGG + Intergenic
1179218114 21:39384553-39384575 AAAAAAAAAAATTGTCGGCCAGG - Intronic
1180245971 21:46547538-46547560 AAGAAGCAAAATTCTCTTCCTGG - Intronic
1181698666 22:24607922-24607944 AAGAGACAGACTTGTCTGCCTGG - Intronic
1182822382 22:33228383-33228405 AAGAAGCAGAATAGTTGTGCTGG - Intronic
1184587036 22:45454864-45454886 AAGAAGCAGTATTTTCTTCCAGG + Intergenic
1185300381 22:50076918-50076940 AAGAAACAGAACTGTCACCCCGG + Intronic
955226819 3:57067154-57067176 AAGAATAACATTTGTCGGCCAGG + Intronic
955262225 3:57404418-57404440 AAGAAACAAAAGTTTCGGCCAGG + Intronic
956499530 3:69866941-69866963 AAACATCAGAATTGTCTGCCTGG + Intronic
957682645 3:83457468-83457490 GAGAAGCAGAACTGTGGCCCTGG - Intergenic
957839909 3:85654517-85654539 AAGAAGCATGATTGTCAGCCAGG + Intronic
960922479 3:122761472-122761494 AAAAAGCAAAACTGTCAGCCAGG + Intronic
962349132 3:134644118-134644140 AAGAAGCAGGAGGCTCGGCCGGG - Intronic
962796643 3:138855349-138855371 ATAAAACAGAAATGTCGGCCAGG - Intergenic
964139992 3:153386733-153386755 AAAAAGCAAAAATGTTGGCCAGG - Intergenic
964335477 3:155649681-155649703 AAGAAGTAGAATTAATGGCCGGG + Intronic
967333715 3:188319051-188319073 AAGAATCATAATTTTTGGCCGGG - Intronic
968149783 3:196328004-196328026 AAGAAGTAATATTGTCGGCCAGG + Intronic
968476506 4:812441-812463 AAAAAGCAGAATTGTCAGATTGG - Intronic
968839035 4:2987643-2987665 CAGAAGCAGAATTGTTGGCCAGG + Intronic
971000533 4:22317422-22317444 AAGACAAGGAATTGTCGGCCGGG + Intergenic
972321379 4:37976547-37976569 GAGAAGCAGAATTCTTGGGCTGG + Intronic
973232607 4:47859545-47859567 AAAAAGCAGAAATACCGGCCAGG + Intronic
975338666 4:73211549-73211571 AAGAAATCTAATTGTCGGCCAGG + Intronic
975749450 4:77508016-77508038 ATAAAGCAGTATTGTAGGCCAGG + Intergenic
975859256 4:78658675-78658697 TAGAAGTAGATTTGTGGGCCAGG - Intergenic
977106261 4:92889245-92889267 AAGAAGCAGAAGTTCTGGCCAGG + Intronic
978786606 4:112616539-112616561 AAGAAACACAATTATGGGCCAGG + Intronic
980905102 4:138940657-138940679 AAGAAAAAGAATTTTGGGCCGGG + Intergenic
981828615 4:148974086-148974108 AAGAAAAAGAATTGTCGACCGGG - Intergenic
984427833 4:179610543-179610565 AACAAGCAGAACTGTAGGTCTGG + Intergenic
985272131 4:188203619-188203641 AAGAAGCAGAATTATGGGCCGGG - Intergenic
985285280 4:188330771-188330793 AAGTATCAGAAGTGTGGGCCTGG - Intergenic
986001795 5:3636147-3636169 AAGAACCACAATTTTCGGCCAGG - Intergenic
986266150 5:6193057-6193079 AGGAAGCAGAATTGCCTGTCAGG - Intergenic
986310364 5:6546660-6546682 AAGAAGCAGGATGGTCAGCTGGG - Intergenic
986966317 5:13276268-13276290 AAGTAGCTGGAATGTCGGCCTGG + Intergenic
987632604 5:20494335-20494357 AAGAAGCAGTAATGTCTGCAGGG + Intronic
992635653 5:78723712-78723734 AAGAATCAGAAATCTAGGCCAGG + Intronic
992843453 5:80719511-80719533 AAGAACCAGGATTGTCGACATGG - Intronic
993467847 5:88269511-88269533 AAGAGGCAGAATTTTCTTCCTGG - Intergenic
995036146 5:107536809-107536831 AAGAAGTAGATTTTTCGGCCGGG + Intronic
995267062 5:110174396-110174418 GAGAAGCAGATTTGTGGTCCAGG + Intergenic
998066286 5:139161719-139161741 AAGAATTAGAATTGCTGGCCAGG + Intronic
998883836 5:146673567-146673589 AAAATGCAGAATTCTCAGCCTGG - Intronic
999285993 5:150394619-150394641 AAGCAGCAGAAAAGTGGGCCTGG + Intronic
999579349 5:153018620-153018642 TAAAAGTAAAATTGTCGGCCGGG + Intergenic
999579911 5:153026546-153026568 AAGGAGCAGAATAGGCAGCCTGG + Intergenic
1003132266 6:3404963-3404985 AAAAAAAAGATTTGTCGGCCAGG + Intronic
1004362062 6:14979897-14979919 AAGAATGTGAATTGTGGGCCAGG - Intergenic
1004847157 6:19656876-19656898 AAGAAACATAATTCTAGGCCGGG - Intergenic
1005436874 6:25821456-25821478 ATGAAGCAGAATGCTCAGCCAGG + Intronic
1007020870 6:38520156-38520178 AATACACAAAATTGTCGGCCAGG + Intronic
1016393520 6:143598569-143598591 TAAAAGCAGAAGTGTGGGCCAGG + Intronic
1016944087 6:149512011-149512033 AAGAAGCAGAATGGTTGCACTGG - Intronic
1017557737 6:155590309-155590331 AAGAAATAGTATTGTCTGCCTGG - Intergenic
1018646961 6:165957899-165957921 AAGGAGCTGGATTTTCGGCCAGG - Intronic
1019343545 7:519366-519388 AATATGCAGAATTACCGGCCGGG - Exonic
1022204130 7:28147139-28147161 AAAAATCAGAATTCTGGGCCAGG - Intronic
1022979804 7:35593831-35593853 AAGAAACAGGCTTGTCGGACTGG + Intergenic
1025773607 7:64537630-64537652 AAAAAACAGAATAGACGGCCAGG + Intronic
1027775536 7:82459993-82460015 AAGAAGAAGAATTGTCTTCTTGG + Intergenic
1028154635 7:87415913-87415935 AAGAAGCAGGATTGAGGGGCAGG + Intronic
1031302440 7:120079412-120079434 CAGAAGCAGAACTGTCATCCAGG - Intergenic
1031600403 7:123700731-123700753 AAGAGGTAGAATAGTTGGCCGGG - Intronic
1033209244 7:139448289-139448311 AAAAAGGAGAAATGTTGGCCAGG - Intergenic
1034509972 7:151526073-151526095 AAGAAACAAGATTGTCGACCAGG - Intergenic
1034510023 7:151526433-151526455 AAGAAACAAGATTGTCGACCAGG - Intergenic
1034531986 7:151701546-151701568 AAGAATAAGGATTGCCGGCCGGG + Intronic
1036980318 8:13462699-13462721 AAGAATAAGAATAGTAGGCCGGG - Intronic
1037032388 8:14125184-14125206 AAGAATCACTATTGTTGGCCAGG + Intronic
1037486939 8:19356708-19356730 AAAGAGGAGAATTGTGGGCCAGG + Intronic
1037771754 8:21805225-21805247 AAGAAACAGAATTGTAGACTAGG - Intronic
1041285559 8:56257773-56257795 AAGATGCAGTTTTGTCAGCCAGG + Intergenic
1041633170 8:60111048-60111070 AAGAAGCATAATTATAGGCCGGG - Intergenic
1046503402 8:115107979-115108001 AAAAAGCTGAATTTTAGGCCAGG + Intergenic
1050252274 9:3757495-3757517 AAGAAGGAGTATTCTAGGCCAGG + Intergenic
1050655013 9:7818443-7818465 AAGAAATAAAATTGTCGGCCGGG - Intronic
1051759463 9:20445257-20445279 AAGAAGAAGTATTGTGGGCAGGG - Intronic
1052782041 9:32791369-32791391 AATGAGCAGAATTGTGGGCATGG + Intergenic
1053491328 9:38506470-38506492 AAGAAGAAAACTTGTAGGCCAGG + Intergenic
1053580678 9:39400969-39400991 AAGAATCAATATTGTTGGCCAGG + Intergenic
1053845174 9:42229017-42229039 AAGAATCAATATTGTTGGCCAGG + Intergenic
1054102265 9:60959774-60959796 AAGAATCAATATTGTTGGCCAGG + Intergenic
1054584094 9:66947088-66947110 AAGAATCAATATTGTTGGCCAGG - Intergenic
1055730756 9:79277512-79277534 AAAAAGAAGCATTGCCGGCCAGG + Intergenic
1056315603 9:85386663-85386685 AAGGAGAAGAAATGTCGGCTTGG + Intergenic
1058339599 9:103878224-103878246 AAGAATCAGAATTATTGGCCGGG - Intergenic
1058727402 9:107817387-107817409 AAGAATTAAAATTCTCGGCCAGG + Intergenic
1060268782 9:122127173-122127195 CAGAAGCAGAATTGCAAGCCGGG - Intergenic
1061109688 9:128560028-128560050 AAAAATCAAAATTATCGGCCAGG - Intronic
1188865893 X:35312715-35312737 AAGAAAAAGAATTGTAGGCCAGG + Intergenic
1189832863 X:44992516-44992538 AAAAAGCAGTATTGCTGGCCAGG - Intronic
1194496152 X:94620142-94620164 AAGAAGCAAAAGTGGAGGCCGGG + Intergenic
1195471253 X:105232991-105233013 AAAAAGCTGAATAGTTGGCCAGG + Intronic
1195554004 X:106200751-106200773 AAGAAACAGAATTGCCGGCCGGG + Intronic
1196430877 X:115623932-115623954 AAAATGCACACTTGTCGGCCGGG + Intronic
1199903088 X:152196839-152196861 AAGAAGTAGCATTGTAGGTCAGG - Intronic
1200298710 X:154950058-154950080 AAGAAGAGGAAATGTGGGCCAGG - Intronic
1201317364 Y:12661044-12661066 AAGAAGTACAAGTGTTGGCCAGG - Intergenic