ID: 1113984563

View in Genome Browser
Species Human (GRCh38)
Location 13:114303493-114303515
Sequence GCAGAATTGTCGGCCCGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113984555_1113984563 18 Left 1113984555 13:114303452-114303474 CCATGCTCCATCTGTGTATACAG 0: 1
1: 0
2: 2
3: 18
4: 200
Right 1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG 0: 1
1: 0
2: 0
3: 7
4: 112
1113984557_1113984563 11 Left 1113984557 13:114303459-114303481 CCATCTGTGTATACAGGTATTGC 0: 1
1: 0
2: 0
3: 20
4: 120
Right 1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG 0: 1
1: 0
2: 0
3: 7
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113984563 Original CRISPR GCAGAATTGTCGGCCCGGTG CGG Intronic
900265494 1:1755107-1755129 ACAGAAGTGTCGGCCGGGCGCGG - Intronic
908525952 1:64987516-64987538 GAAGAATTGTTTGCCTGGTGTGG + Intergenic
909853199 1:80495579-80495601 GCAGATTTTTGGGCCGGGTGCGG - Intergenic
914822112 1:151112629-151112651 CCAGCATAGTCGGCCAGGTGCGG - Intronic
916085771 1:161268001-161268023 ATAGTATTGTCGGCCAGGTGCGG - Intronic
920612461 1:207454710-207454732 GCTGTCTGGTCGGCCCGGTGTGG + Intronic
924263828 1:242260056-242260078 AGAGAATTGTTGGCCAGGTGGGG + Intronic
1064213534 10:13380953-13380975 ACAGAATTTTTGGCCAGGTGTGG + Intergenic
1064572123 10:16704618-16704640 ACAGAATTCTGGGCCCTGTGAGG - Intronic
1064735733 10:18379975-18379997 GTAGAATAGTGGGCCAGGTGTGG - Intronic
1065922095 10:30401901-30401923 GCAGAATATTCGGCCGGGTGCGG + Intergenic
1066720970 10:38338416-38338438 AGAGAATTGTTGGCCAGGTGGGG - Intergenic
1068104478 10:52596845-52596867 ACAGAAATGTTGGCCAGGTGCGG + Intergenic
1069458754 10:68575091-68575113 GAAGTATTGTAGGCCTGGTGTGG + Intronic
1069672507 10:70220218-70220240 GCATAATTGCAGGCCAGGTGCGG - Intronic
1069977979 10:72231082-72231104 GCAGAAATGAAGGCCTGGTGAGG - Intronic
1070199016 10:74185540-74185562 GCAGAGTCGTCGGCCGGGCGCGG + Intronic
1075856829 10:125637009-125637031 GTAGAATTATAGGCCTGGTGCGG + Intronic
1076083590 10:127605816-127605838 TAAGAATTGTGGGCCGGGTGCGG + Intergenic
1077111628 11:864572-864594 GGAGCACTGTGGGCCCGGTGTGG + Intronic
1083905241 11:65664831-65664853 ACAGAATTCTGGGCCAGGTGTGG - Intergenic
1084191510 11:67501374-67501396 GCTGAATTGTAGGCGTGGTGGGG + Intronic
1084745366 11:71166771-71166793 AAAGAAGTGTGGGCCCGGTGTGG - Intronic
1087544284 11:99564376-99564398 ACAGAATTGTTGGCCAGGTGTGG - Intronic
1088025787 11:105180768-105180790 TCAGGATTGTCGGCCGGGCGCGG + Intergenic
1092427372 12:8385633-8385655 GCAGCACTTTCGGCCCGGGGGGG + Intergenic
1095245111 12:39910792-39910814 TCAGAAATGTAGGCCAGGTGTGG + Intronic
1103818613 12:123679085-123679107 GCTGAATTATCGGCCAGGCGCGG - Intronic
1105374135 13:19828181-19828203 GCAGAGGTGTGGGCCAGGTGCGG + Intronic
1109305681 13:60638217-60638239 GTAGAGTTTTCGGCCAGGTGCGG + Intergenic
1113144080 13:107187444-107187466 GCAGAATTATCTGCAGGGTGAGG + Intronic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1114228132 14:20757209-20757231 ACAGTATTGTAGGCCTGGTGAGG - Intergenic
1116810836 14:49538571-49538593 GCAGAATGCTGGGCCAGGTGTGG + Intergenic
1118027155 14:61781157-61781179 TAAGAATTGTTGGCCGGGTGCGG + Intronic
1120748460 14:88175005-88175027 GCAGAATAGTGGGCCTGCTGTGG - Intergenic
1124472791 15:30003094-30003116 GCAAAATTTTCGGCCGGGCGTGG - Intergenic
1124510697 15:30322005-30322027 GCATAATTGAAGGCCAGGTGTGG - Intergenic
1125343253 15:38695089-38695111 GCAGAATTGGGGGGCGGGTGCGG + Intergenic
1125843931 15:42833580-42833602 TAAAAATTGTCGGCCAGGTGTGG + Intronic
1126396072 15:48219252-48219274 GAAAACTTGTCGGCCGGGTGTGG + Intronic
1126762413 15:51981181-51981203 TCAGACTTATCGGCCGGGTGCGG + Intronic
1128984201 15:72207453-72207475 GCAGAATTGTTGGCCCACTCTGG - Intronic
1129834588 15:78694085-78694107 GCAGAATATTCAGCCAGGTGTGG - Intronic
1131026266 15:89144421-89144443 ACTGAATGGTAGGCCCGGTGTGG - Intronic
1133179133 16:4039386-4039408 GCAGGATTGCAGGCCAGGTGCGG + Intronic
1135512638 16:23100480-23100502 GCAGAATAGTGGGCCGGGTGTGG + Intronic
1139765337 16:69223918-69223940 GAAGAACTGTCGGCCGGGTGTGG - Intronic
1140225353 16:73072158-73072180 TCAGAAATGTAGGCCAGGTGGGG + Intergenic
1143481870 17:7231973-7231995 GCAGAATTTTGTGCCCAGTGAGG - Intronic
1145036686 17:19545778-19545800 TAAGAATTGTTGGCCAGGTGTGG - Intronic
1151331268 17:73410605-73410627 GCAGCATTATCGGCCGGGGGTGG - Intronic
1152661401 17:81543985-81544007 GCAGGTATGTCGGCCCGCTGGGG - Exonic
1155487767 18:26365295-26365317 ACAGAATTATAGGCCAGGTGCGG - Intronic
1155649708 18:28126783-28126805 GCAGAACTATCGGTCTGGTGGGG + Intronic
1158465432 18:57685955-57685977 ACACAATTGTAGGCCGGGTGTGG + Intronic
1160775487 19:853258-853280 GCAGAAACGTCCGCGCGGTGCGG + Exonic
1161889178 19:7021746-7021768 ATGGAATTGTCGGCCGGGTGCGG + Intergenic
1161892274 19:7049003-7049025 ATGGAATTGTCGGCCGGGTGCGG - Intergenic
1163266503 19:16225548-16225570 GCAGGACCGTCGCCCCGGTGTGG + Intronic
1163287217 19:16356211-16356233 GCAGAATTGTCTGCGCCGTGGGG - Intronic
1164805077 19:31110202-31110224 GCTGATTTGTGGGTCCGGTGTGG + Intergenic
1165048018 19:33121607-33121629 GGAGACTTGGCGGCCGGGTGCGG - Intronic
1168143727 19:54407184-54407206 GTAGAATTGTTGGCCGGGCGTGG + Intergenic
1168592663 19:57650356-57650378 GTATAATTTTCGGCCGGGTGTGG + Intergenic
927662624 2:25005754-25005776 GCAGTATTTTGGGCCGGGTGCGG + Intergenic
928056537 2:28061966-28061988 CCAGGATTGTTGGCCAGGTGCGG + Intronic
930128664 2:47825865-47825887 TCAGATTTGTCGGCCCGGCATGG - Intronic
941780054 2:169433875-169433897 GTAGAAGTGTAGGCCCAGTGTGG - Intergenic
946027338 2:216679723-216679745 CCAGAAATGTAGGCCCGGAGGGG + Intronic
946315886 2:218911935-218911957 TCAGAGTTGTAGGCCAGGTGTGG + Intergenic
946627706 2:221632175-221632197 ATAGACTTGTCGGCCAGGTGCGG + Intergenic
946953141 2:224898863-224898885 GCTCAATTATCAGCCCGGTGCGG - Intronic
948800047 2:240429394-240429416 GCAGGGTTGTCAGCCAGGTGAGG - Intergenic
949005511 2:241644657-241644679 TCAGAAGTGTCGGCCGGTTGCGG + Intronic
1171982213 20:31636169-31636191 ACAGAATTGTAAGCCCTGTGGGG + Intergenic
1175313302 20:58026622-58026644 GCAGAAATGTGGGCCCAGTGAGG + Intergenic
1175438984 20:58977506-58977528 GAAGAATTCTGGGCCGGGTGCGG - Intergenic
1177329918 21:19645403-19645425 GCTAAATTGTCAGCCCAGTGAGG - Intergenic
1179218113 21:39384548-39384570 AAAAAATTGTCGGCCAGGTGTGG - Intronic
1181287991 22:21768248-21768270 AAAGAATTGTGGGCCAGGTGCGG - Intronic
1184181512 22:42831007-42831029 ACAGAAGGGTCGGCCAGGTGTGG + Intronic
1184181714 22:42832693-42832715 GCTAAATAGTAGGCCCGGTGTGG + Intronic
958955443 3:100461019-100461041 GCAGAAGTGACGGCCGGGCGCGG - Intergenic
963345999 3:144097208-144097230 GCAGAACTGTCGGGGGGGTGGGG + Intergenic
964358061 3:155868634-155868656 ACAGACTTGTTGGCCAGGTGCGG - Intergenic
969367050 4:6702009-6702031 TCAGAATTGTTGGCCAGGCGTGG - Intergenic
970975570 4:22039455-22039477 AAAGAATTTTCGGCCAGGTGTGG - Intergenic
972675232 4:41254098-41254120 GCAGAATTCTTAGCCAGGTGTGG - Intergenic
974860684 4:67517545-67517567 ACTGCATTGTCGGCCGGGTGCGG + Intronic
981111056 4:140933919-140933941 GCAGAATTGTCCCCACAGTGTGG - Intronic
985272130 4:188203614-188203636 GCAGAATTATGGGCCGGGCGCGG - Intergenic
985653090 5:1116051-1116073 GCAGAATTCTCGGCCCTGGTGGG - Intergenic
990307896 5:54510920-54510942 GCAGAAATGCTGGCCCTGTGTGG + Intergenic
996736282 5:126761625-126761647 AAAGAATTGTTGGCCGGGTGCGG + Intergenic
998890993 5:146745664-146745686 GATAAATTGTCGGCCAGGTGTGG + Intronic
999579350 5:153018625-153018647 GTAAAATTGTCGGCCGGGCGCGG + Intergenic
1003132267 6:3404968-3404990 AAAGATTTGTCGGCCAGGTGCGG + Intronic
1003384215 6:5652529-5652551 GCAGAAATGAAGGCCCAGTGCGG + Intronic
1004197536 6:13518489-13518511 AAAGAAAAGTCGGCCCGGTGCGG + Intergenic
1007612636 6:43160406-43160428 GCAGTATTTTCGGCCAGGTGTGG - Intronic
1017465628 6:154691213-154691235 TCTGAATTGTCAGCCAGGTGCGG + Intergenic
1019995664 7:4722867-4722889 GCAGAATTGGCATCCAGGTGAGG + Intronic
1023054774 7:36282819-36282841 GCAGTATTGTGGGCCCAATGTGG + Intronic
1027651337 7:80872511-80872533 GCTGAATTCTCGGCCGGGCGTGG + Intronic
1033209243 7:139448284-139448306 GGAGAAATGTTGGCCAGGTGTGG - Intergenic
1035534744 8:382379-382401 GCAGAAGAGGCGGCCCTGTGGGG - Intergenic
1037871211 8:22498832-22498854 GTAGAATTATTGGCCGGGTGCGG + Intronic
1040779702 8:51093295-51093317 GCAGAAATTTAGGCCTGGTGCGG - Intergenic
1049762408 8:144337263-144337285 GCAGCATTGTCGGGCGTGTGGGG + Intergenic
1054579909 9:66901652-66901674 TCAGAATTTTTGGCCAGGTGCGG + Intronic
1057127757 9:92632677-92632699 GCAGAGTTGTCATCCTGGTGAGG - Intronic
1062153853 9:135035122-135035144 GCAGGATTGCCAGCCAGGTGCGG + Intergenic
1203759349 EBV:3998-4020 GCCGAGTTGTCTGCCCGGCGCGG - Intergenic
1190679402 X:52811792-52811814 GCAGAGGTGCCCGCCCGGTGAGG + Intergenic
1192783215 X:74314768-74314790 ACACAATTGTCGGCCGGGCGCGG - Intergenic
1195554005 X:106200756-106200778 ACAGAATTGCCGGCCGGGCGCGG + Intronic
1197210000 X:123820515-123820537 GTGGATTTGTCGGCCGGGTGAGG - Intergenic
1197973829 X:132143846-132143868 GTAGAATTGTCAGCCAGATGTGG - Intergenic
1201272432 Y:12268026-12268048 GAAAAATTGTAGGCCGGGTGCGG - Intergenic