ID: 1113984564

View in Genome Browser
Species Human (GRCh38)
Location 13:114303496-114303518
Sequence GAATTGTCGGCCCGGTGCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2317
Summary {0: 1, 1: 2, 2: 19, 3: 279, 4: 2016}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113984560_1113984564 -9 Left 1113984560 13:114303482-114303504 CCTGGTAAGAAGCAGAATTGTCG 0: 1
1: 0
2: 0
3: 2
4: 81
Right 1113984564 13:114303496-114303518 GAATTGTCGGCCCGGTGCGGTGG 0: 1
1: 2
2: 19
3: 279
4: 2016
1113984559_1113984564 -8 Left 1113984559 13:114303481-114303503 CCCTGGTAAGAAGCAGAATTGTC 0: 1
1: 0
2: 1
3: 8
4: 159
Right 1113984564 13:114303496-114303518 GAATTGTCGGCCCGGTGCGGTGG 0: 1
1: 2
2: 19
3: 279
4: 2016
1113984555_1113984564 21 Left 1113984555 13:114303452-114303474 CCATGCTCCATCTGTGTATACAG 0: 1
1: 0
2: 2
3: 18
4: 200
Right 1113984564 13:114303496-114303518 GAATTGTCGGCCCGGTGCGGTGG 0: 1
1: 2
2: 19
3: 279
4: 2016
1113984557_1113984564 14 Left 1113984557 13:114303459-114303481 CCATCTGTGTATACAGGTATTGC 0: 1
1: 0
2: 0
3: 20
4: 120
Right 1113984564 13:114303496-114303518 GAATTGTCGGCCCGGTGCGGTGG 0: 1
1: 2
2: 19
3: 279
4: 2016

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113984564 Original CRISPR GAATTGTCGGCCCGGTGCGG TGG Intronic
Too many off-targets to display for this crispr