ID: 1113987187

View in Genome Browser
Species Human (GRCh38)
Location 13:114327592-114327614
Sequence AAGCATTCTGATGTGTAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 199}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113987181_1113987187 30 Left 1113987181 13:114327539-114327561 CCAGTGGTTGCCTATCCTGCCTG 0: 1
1: 0
2: 1
3: 10
4: 175
Right 1113987187 13:114327592-114327614 AAGCATTCTGATGTGTAGCCAGG 0: 1
1: 0
2: 2
3: 22
4: 199
1113987182_1113987187 20 Left 1113987182 13:114327549-114327571 CCTATCCTGCCTGCCTCTAAACA 0: 1
1: 0
2: 2
3: 25
4: 257
Right 1113987187 13:114327592-114327614 AAGCATTCTGATGTGTAGCCAGG 0: 1
1: 0
2: 2
3: 22
4: 199
1113987183_1113987187 15 Left 1113987183 13:114327554-114327576 CCTGCCTGCCTCTAAACAGTGTG 0: 1
1: 0
2: 0
3: 14
4: 150
Right 1113987187 13:114327592-114327614 AAGCATTCTGATGTGTAGCCAGG 0: 1
1: 0
2: 2
3: 22
4: 199
1113987186_1113987187 7 Left 1113987186 13:114327562-114327584 CCTCTAAACAGTGTGAGGCATTT 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1113987187 13:114327592-114327614 AAGCATTCTGATGTGTAGCCAGG 0: 1
1: 0
2: 2
3: 22
4: 199
1113987185_1113987187 11 Left 1113987185 13:114327558-114327580 CCTGCCTCTAAACAGTGTGAGGC 0: 1
1: 0
2: 0
3: 13
4: 225
Right 1113987187 13:114327592-114327614 AAGCATTCTGATGTGTAGCCAGG 0: 1
1: 0
2: 2
3: 22
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113987187 Original CRISPR AAGCATTCTGATGTGTAGCC AGG Intergenic
906198176 1:43942541-43942563 AAGCATTTTGAAGTGTAACAGGG - Intergenic
906200555 1:43957456-43957478 AACTATTCTGATGTGGTGCCTGG + Exonic
906267572 1:44444825-44444847 AAACATTTTTATGTGTATCCTGG + Intronic
906339944 1:44970842-44970864 AGGCAATCTGATATGAAGCCAGG + Intronic
909910691 1:81254643-81254665 GAGCCTCCTGATTTGTAGCCTGG - Intergenic
910109923 1:83672137-83672159 AAGCATTCTGAACTTGAGCCAGG - Intergenic
911051847 1:93678073-93678095 GAGGATTCTTATGTGTAGCCAGG - Intronic
916531924 1:165664787-165664809 GAGGGTTCTGATGTATAGCCTGG - Intronic
917018323 1:170559562-170559584 AAGCATCCTGAAATCTAGCCTGG + Intergenic
917503286 1:175605122-175605144 AATCTTTATGATGTGCAGCCTGG - Intronic
917793819 1:178517548-178517570 AATCGTTATGAGGTGTAGCCTGG - Intronic
920026375 1:203000700-203000722 AATCAGTCTGAGGTGTAGCCTGG - Intergenic
921187778 1:212684808-212684830 GAGGATTATGATGTGGAGCCAGG + Intergenic
921529252 1:216260500-216260522 TAGTATACTGATATGTAGCCAGG + Intronic
921623410 1:217351457-217351479 CATGATTCTGAGGTGTAGCCAGG + Intergenic
922255322 1:223888570-223888592 AAGCATTCTGATGTGGAAAGGGG - Intergenic
922668749 1:227493497-227493519 AAGCATGAAGAAGTGTAGCCAGG + Intergenic
922670847 1:227507802-227507824 AAGCATGAAGAAGTGTAGCCAGG - Intergenic
1065320533 10:24504972-24504994 AATAATTCTAATGAGTAGCCAGG - Intronic
1066604583 10:37149081-37149103 AAGCATTCAGATGTATAAACTGG + Intronic
1068584004 10:58776334-58776356 AAGCACTGTAATCTGTAGCCAGG - Intronic
1069654715 10:70079306-70079328 AATGATTCTGATGGGCAGCCAGG + Intronic
1071943549 10:90615003-90615025 AGTGATTCTAATGTGTAGCCAGG + Intergenic
1072894948 10:99358787-99358809 TAGAATTCTCAGGTGTAGCCTGG + Intronic
1074283217 10:112072918-112072940 TAGCCTTCTGCTGTGTAGACTGG - Intergenic
1074880026 10:117648760-117648782 AAACATCCTTATATGTAGCCAGG - Intergenic
1075762474 10:124866981-124867003 AGGGATTCTGAAGTGCAGCCAGG + Intergenic
1077726070 11:4676221-4676243 AAGAATTCTCATGTTTGGCCGGG + Intergenic
1079021419 11:16912270-16912292 AGGCATTCTAATGTGCAGCCAGG + Intronic
1079706541 11:23627432-23627454 CTGCATTCTGCTGTGTAACCTGG + Intergenic
1087047767 11:93857656-93857678 AATGATTTTGATGTGCAGCCAGG + Intergenic
1089683601 11:120133114-120133136 GAGAATTCTAATGTGTAGCTGGG - Intronic
1092388584 12:8054988-8055010 AAGAATTCTGGCGTGCAGCCAGG + Exonic
1092962652 12:13610877-13610899 GATCATTCTTATGTGTAGCCAGG + Intronic
1093878452 12:24376633-24376655 AAGCATTGTCATGTGTTACCTGG + Intergenic
1096284010 12:50282811-50282833 AAGCTTTAGTATGTGTAGCCAGG + Intronic
1099957246 12:89362817-89362839 GAGAATTCTGATATGTGGCCTGG + Intergenic
1100910241 12:99352385-99352407 AAGCATTCTGATGAGGATCTGGG + Intronic
1101292843 12:103388936-103388958 AAGCTTGCTTATGTGGAGCCTGG - Intronic
1103210926 12:119165749-119165771 GAGCATTCTGATATGAAGCCAGG + Intergenic
1104839708 12:131817295-131817317 AAGCATTCTGATTTCCGGCCTGG - Intergenic
1105417195 13:20223668-20223690 AAGCATTCTCATGTTTGGCCAGG + Intronic
1106226923 13:27792982-27793004 CAGCACTCTGCTGTGTCGCCCGG + Exonic
1107381931 13:39865859-39865881 AATCATTCTGATATGTATCCAGG + Intergenic
1108552887 13:51564088-51564110 AGGAATTCTGGTGTGCAGCCAGG + Intergenic
1109428100 13:62194240-62194262 AAGCAATATGATCTGTTGCCTGG - Intergenic
1111145289 13:84170730-84170752 AAGCTCTCTGATGGGTAGGCAGG + Intergenic
1113987187 13:114327592-114327614 AAGCATTCTGATGTGTAGCCAGG + Intergenic
1114401714 14:22416294-22416316 GATAATTCTGATGTGCAGCCAGG - Intergenic
1114856214 14:26447932-26447954 AAACAATCTGATGTGTAACTGGG + Exonic
1118440750 14:65809357-65809379 AAGCATCCGGATCAGTAGCCTGG + Intergenic
1119519507 14:75275784-75275806 AAGCCTTCTTCTGTGTTGCCTGG + Intergenic
1120137623 14:80888402-80888424 AAGCATTTTGATGTGCTGCTGGG - Intronic
1121567483 14:94921570-94921592 GAAGATTCTGATGTGCAGCCAGG - Intergenic
1122044194 14:99011784-99011806 AAGACTTCTCAGGTGTAGCCAGG + Intergenic
1126672583 15:51129706-51129728 AAGCAGTCTGGAGTGGAGCCAGG - Intergenic
1127839303 15:62816979-62817001 AATTCTTCTGGTGTGTAGCCTGG - Intronic
1128250192 15:66158546-66158568 GATGATTCTGATGTGCAGCCAGG - Intronic
1128634294 15:69293345-69293367 GGGGATTCTGATGTGCAGCCAGG - Intergenic
1128785897 15:70396812-70396834 AGGCATTCTGACATGGAGCCCGG - Intergenic
1130576808 15:85100381-85100403 GAGCATTCTGATGGGTGCCCTGG + Intronic
1131428440 15:92366656-92366678 AATGATTCTAATGTGCAGCCAGG - Intergenic
1132276856 15:100574113-100574135 AAACATCCTGATGTGTTTCCTGG - Exonic
1133217740 16:4303634-4303656 AAGAAATCTGTTGGGTAGCCAGG + Intergenic
1133233151 16:4375855-4375877 GATGATTCTGATGTGCAGCCCGG + Intronic
1133333401 16:4990546-4990568 AAGCCTTCTCATGAGAAGCCGGG - Intronic
1134915771 16:18069714-18069736 AACCATTCTAATGTGTAGCCAGG - Intergenic
1135132726 16:19866241-19866263 AGTCATTGTAATGTGTAGCCTGG + Intronic
1137388600 16:48062742-48062764 AATCATTCTGAAATGAAGCCAGG + Intergenic
1139179272 16:64726530-64726552 GCACATGCTGATGTGTAGCCGGG + Intergenic
1139836517 16:69843140-69843162 AAGCATTTCTATGTGTATCCTGG - Intronic
1140822129 16:78672495-78672517 AGGTATCCTGATGGGTAGCCAGG + Intronic
1144272516 17:13631733-13631755 AAGCATTCTGATGGGACACCTGG - Intergenic
1145721555 17:27077945-27077967 AGGCATTCTGATGTATAGTGTGG - Intergenic
1146516704 17:33495264-33495286 AGGGATTCTGATGGGTACCCAGG + Intronic
1146978794 17:37140455-37140477 ATGCATATTGATCTGTAGCCAGG - Intronic
1147731190 17:42603680-42603702 TAGAAATCTGATGTGTAGCCGGG + Intronic
1148995921 17:51709590-51709612 AATTATTCTAATGTGCAGCCAGG + Intronic
1149696960 17:58623659-58623681 GGTGATTCTGATGTGTAGCCAGG - Intronic
1150786193 17:68164972-68164994 AATCATTCAGATTTGTGGCCAGG + Intergenic
1151042739 17:70882673-70882695 ATGCATTCTGGTGAGTAGTCGGG + Intergenic
1151154211 17:72113493-72113515 AAGCATTTTGATATTTAGTCAGG - Intergenic
1152388387 17:79988804-79988826 AAGCATGGTGCTGTGTAGCCCGG + Intronic
1152496562 17:80676858-80676880 AGGCATCCTGATTTGCAGCCTGG + Intronic
1152996120 18:407829-407851 AGTGATTCTGATGTGCAGCCAGG - Intronic
1153512224 18:5868642-5868664 GACTATTCTAATGTGTAGCCAGG + Intergenic
1153520323 18:5946439-5946461 ACTGATTCTGATGTGGAGCCAGG + Intergenic
1153615018 18:6926262-6926284 AAACATTAAGATTTGTAGCCAGG + Intergenic
1155266904 18:24103138-24103160 TAACATTCTGATGTGGAGCAAGG - Intronic
1156404422 18:36770735-36770757 GAACATTCTAATGTGTATCCAGG - Intronic
1157055725 18:44226235-44226257 AAGCTTTCTGATGTGCTGCTGGG + Intergenic
1157145773 18:45160841-45160863 AATCATTCTCATGTGCAGGCTGG - Intergenic
1157483091 18:48068460-48068482 GAGGTGTCTGATGTGTAGCCTGG - Intronic
1157513510 18:48295239-48295261 ATGCATTCTGATGAGTCCCCAGG + Intronic
1158235870 18:55313266-55313288 AAACATTTTGTTGTGAAGCCGGG + Intronic
1159845186 18:73450698-73450720 AAGCATTCAGTTGTCTAGACTGG - Intergenic
1164082522 19:21872048-21872070 AAACATAATGATGTATAGCCAGG - Intergenic
1164088585 19:21927730-21927752 AGGCATTGTGATGTATTGCCAGG + Intergenic
1164191623 19:22923419-22923441 AGGCATTGTGATGTATTGCCAGG + Intergenic
925662835 2:6221255-6221277 AGGCATTCGGAAGTGGAGCCAGG + Intergenic
925670098 2:6302123-6302145 CAGCATCCTGATTTGAAGCCTGG + Intergenic
928095343 2:28401340-28401362 GAATATTCTAATGTGTAGCCAGG + Intronic
929675127 2:43919025-43919047 ACACATTCTGCTGTGCAGCCCGG - Intronic
935155569 2:100480916-100480938 AAGCAATCTGAATTTTAGCCAGG - Intronic
935419382 2:102851562-102851584 GAGTATTCTAATGTGTAGCCAGG - Intergenic
936842384 2:116787675-116787697 AAGCAGCCTGATGTGTAGCTTGG - Intergenic
937079234 2:119128456-119128478 AGTGATTCTGATGTGCAGCCAGG - Intergenic
938621447 2:133059002-133059024 AAATATTCTGATATGCAGCCAGG + Intronic
938844552 2:135195377-135195399 AAGCAGTCTGTTCTGTAGACAGG - Intronic
941195980 2:162452427-162452449 AAACATTCTGCTGTGTAAACAGG - Intronic
941381176 2:164794209-164794231 CAGCCTTCTGATCTGTATCCTGG + Intronic
941563208 2:167075582-167075604 AAGCATTATAATTTATAGCCAGG + Intronic
942689952 2:178574679-178574701 ATGCATGCTGATGTGATGCCTGG + Exonic
942939142 2:181596779-181596801 AGGGATTCTAATGTGTTGCCAGG - Intronic
943624016 2:190179578-190179600 AAGCATTCTTATTTTTATCCAGG - Intronic
944659030 2:201905012-201905034 TATTATTCTAATGTGTAGCCAGG + Intergenic
944691682 2:202164415-202164437 AATAATTCTAATGTGTAGCCAGG + Intronic
947372583 2:229463760-229463782 AAGTATTCTGCTGCGTAGCACGG + Intronic
1170335491 20:15266446-15266468 AATCACTCTAAAGTGTAGCCAGG + Intronic
1172005065 20:31813671-31813693 AAAGATTCTGATGTGTGGCAGGG - Intergenic
1172323514 20:34016549-34016571 AGTCCTTCTGTTGTGTAGCCAGG + Intronic
1174803559 20:53585879-53585901 AAGAATTCTGCTGTTTTGCCAGG - Intronic
1175852177 20:62099480-62099502 AGGCATTCTAATAAGTAGCCGGG - Intergenic
1178627036 21:34227016-34227038 GGGGATTCTGATGTGAAGCCAGG + Intergenic
1178796831 21:35752655-35752677 AGACCTTCTGATGTGTAACCAGG + Intronic
1178888734 21:36502876-36502898 AAGTGTTCTAATGTGTAGCCTGG - Intronic
1179392015 21:41002587-41002609 AACCATTCTGAAGTATATCCAGG - Intergenic
949719094 3:6967830-6967852 GGGCATTCTGATGGGCAGCCAGG - Intronic
953774920 3:45808439-45808461 TAGGATCCTGATGTGCAGCCAGG - Intergenic
954231075 3:49218201-49218223 AAGCAAGCTGAGGTGTATCCTGG + Intronic
955331582 3:58051696-58051718 AAGCTTTTTGATGTGTAGCCAGG + Intronic
956296817 3:67724033-67724055 AAGCACTCTGCTGTGTAGGAAGG - Intergenic
956452066 3:69385221-69385243 GAGCATTCCAACGTGTAGCCGGG + Intronic
956532393 3:70234991-70235013 GATGATTCTAATGTGTAGCCAGG + Intergenic
956743586 3:72293885-72293907 GAGGATTCTAATGTGCAGCCTGG + Intergenic
959942205 3:112091601-112091623 AGTGATTCTGATGTGCAGCCAGG + Intronic
962208074 3:133452022-133452044 AATAATTCTGCTGCGTAGCCAGG - Intronic
962433892 3:135346962-135346984 AAGCCTGCTGGTGTCTAGCCTGG - Intergenic
963052216 3:141151985-141152007 AGGGATTCTAATGTGCAGCCAGG - Intergenic
963670262 3:148242405-148242427 AAGGATTCTCCTGTGAAGCCAGG + Intergenic
964094138 3:152911928-152911950 AGTGATTCTAATGTGTAGCCAGG - Intergenic
964849190 3:161076671-161076693 CAGCATTCTCATGGGCAGCCAGG + Exonic
965413435 3:168362015-168362037 AAGCATTTTGATGTCTAGTATGG + Intergenic
965502336 3:169471704-169471726 AGGCATTGTGATGAGGAGCCAGG - Intronic
966363176 3:179151473-179151495 GATTATTCTAATGTGTAGCCAGG - Intronic
967948569 3:194823165-194823187 GCTCCTTCTGATGTGTAGCCAGG - Intergenic
969526793 4:7707928-7707950 AAGCATCCTGATTTGGAGACGGG - Intronic
972189480 4:36573048-36573070 AGGCATTCTCAAGTGGAGCCAGG + Intergenic
976375239 4:84338717-84338739 AAGCACTCTGAGGGGTAGGCAGG + Intergenic
976474101 4:85462742-85462764 AGGCATTCTGATGTGGAGACAGG + Intergenic
981401835 4:144322318-144322340 AAGCACTCTGGTGGGTAGGCAGG - Intergenic
983151210 4:164283613-164283635 ACGCATTCTGATGAGTTTCCAGG - Intronic
986957731 5:13175335-13175357 AAGCATTCTTATGTCTAGACTGG - Intergenic
988621598 5:32829172-32829194 AAGAATTCTGATGGGAAACCTGG + Intergenic
988696736 5:33628983-33629005 AGGCATTCTAATAAGTAGCCAGG - Intronic
989255933 5:39365702-39365724 GATCATTCTAACGTGTAGCCAGG + Intronic
990369493 5:55102864-55102886 AAGCCTTATAATGTTTAGCCAGG + Intronic
991937811 5:71819019-71819041 AGGCATTCTGATGAGTAGGTTGG - Intergenic
995551174 5:113283065-113283087 AAGCATTCTGATGCTTTGTCGGG - Intronic
1000340186 5:160271003-160271025 AAGCATTGTGGTGTCTAGACAGG - Intronic
1000669231 5:164039921-164039943 GAGGATTTTCATGTGTAGCCAGG + Intergenic
1001661390 5:173396193-173396215 AATCATCCAGATGTGTAGGCTGG - Intergenic
1002697425 5:181100256-181100278 AAGCATCCTGCAGTCTAGCCAGG - Intergenic
1002974059 6:2056574-2056596 AGTGATTCTGATGGGTAGCCAGG - Intronic
1004505423 6:16243280-16243302 GAGGATTCTGATGTGTACCCGGG + Intronic
1004690915 6:17991338-17991360 AAGCATTTGGATTTGGAGCCAGG + Intergenic
1007965263 6:45998593-45998615 GAACATTCTGATGTGAATCCAGG - Intronic
1007993210 6:46279042-46279064 AATGATTCTAATATGTAGCCAGG + Intronic
1008080166 6:47186239-47186261 ATTGATTCTAATGTGTAGCCAGG + Intergenic
1013206568 6:107951998-107952020 AGTGATTCTAATGTGTAGCCAGG + Intronic
1015325433 6:131918594-131918616 AAGCAAGCTGATGTGGAGCCAGG + Intergenic
1015948398 6:138526185-138526207 AAACATTCTATTTTGTAGCCAGG + Intronic
1017973975 6:159338180-159338202 AAGCATTCTGTTGGGAAGGCTGG + Intergenic
1020954006 7:14716782-14716804 GATGATTCTGATGTATAGCCAGG + Intronic
1021871476 7:25011250-25011272 AATTATTTTGATGTGAAGCCAGG - Intergenic
1022164811 7:27747889-27747911 AATGATTCTAATGTGTAACCAGG + Intronic
1022309927 7:29187426-29187448 AAAGATTCTGATGTATGGCCAGG + Intronic
1022426347 7:30272245-30272267 GGGGATTCTGATGTGAAGCCAGG + Intergenic
1022601330 7:31762967-31762989 AAGCAATCTGATGTGCACCCGGG - Intronic
1022804022 7:33803959-33803981 AAACATTCTGAAGTGTAACTTGG - Intergenic
1022974586 7:35545678-35545700 GGGGATTCTGATGTGTATCCAGG - Intergenic
1024474648 7:49797852-49797874 TAGAATTTAGATGTGTAGCCTGG - Intronic
1026053286 7:66964639-66964661 AGGCATGCTGATGTTTAGTCAGG + Intergenic
1026624517 7:71980484-71980506 AAGAATTCTGATGTGTTGGCTGG - Intronic
1030192936 7:106827537-106827559 AAGCATTGGTATGTGTAGCATGG - Intergenic
1032726906 7:134598438-134598460 AAGCTTTTTGATGTGTTGCTGGG + Intergenic
1033271444 7:139936401-139936423 AGGCATTTTGATGTGTCACCTGG - Intronic
1035027104 7:155833285-155833307 GGTGATTCTGATGTGTAGCCAGG + Intergenic
1036402638 8:8423870-8423892 TGGCCTTCTGATGTGCAGCCTGG + Intergenic
1036628549 8:10493707-10493729 AAGCTTTTTGATGTGTTGCTGGG + Intergenic
1037226258 8:16594868-16594890 AAGGGTTCTGATGTGGAGCTTGG + Intergenic
1037623599 8:20588766-20588788 GAGGATTCTGATCTGTAGCTAGG + Intergenic
1037761496 8:21744736-21744758 AAGCCTTCTGATAAGGAGCCTGG - Intronic
1041779377 8:61560889-61560911 AAACATTCTGAAGTGTTGACTGG - Intronic
1042779684 8:72476919-72476941 AAGCCTTCTGATTTGTAGTTTGG - Intergenic
1047462823 8:125084918-125084940 GATGATTCTGATGTGAAGCCAGG + Intronic
1047904577 8:129459638-129459660 AAGGATTCTGCAGTGTAGCAGGG - Intergenic
1048462862 8:134637079-134637101 AAGCATTCTGATGGAAAGTCAGG - Intronic
1048827433 8:138442637-138442659 AAACATTCTGGAGAGTAGCCAGG + Intronic
1050152821 9:2634026-2634048 AACCATTCTGCTTTGTAGCTGGG + Intronic
1050211036 9:3256357-3256379 ATTAATTCTGATGTGCAGCCAGG + Intronic
1051045410 9:12867185-12867207 AAGCTTTCTGATGTGCTGCTGGG + Intergenic
1051533964 9:18136168-18136190 AATGATTCTGATGTGCAGCCAGG - Intergenic
1051696294 9:19771518-19771540 TAGCATTCAGATGAGCAGCCAGG - Intronic
1053332871 9:37232319-37232341 GATGATTCTAATGTGTAGCCAGG - Intronic
1059323553 9:113487830-113487852 AGGAATTCTGATGTATATCCAGG - Intronic
1061010226 9:127950349-127950371 GAGGATTCTGATGAGCAGCCTGG + Intronic
1062193144 9:135257834-135257856 AAGAATTCTGATGCCTGGCCTGG - Intergenic
1185760470 X:2686771-2686793 AAGCCTTCTGAATTGTATCCAGG - Intergenic
1186859315 X:13655776-13655798 GAGGATTCTAATGTGCAGCCAGG + Intronic
1186885612 X:13910228-13910250 AATGATTCTGATGTGCAGCCAGG - Intronic
1186951077 X:14625750-14625772 AGTGATTCTAATGTGTAGCCAGG + Intronic
1187040814 X:15593727-15593749 GATAATTCTAATGTGTAGCCAGG - Intronic
1188775131 X:34207560-34207582 AACCATTCTCCTGTGTAGCATGG - Intergenic
1189081584 X:37978497-37978519 AAGCATTATGATGTGTGACCAGG - Intronic
1189952451 X:46246566-46246588 AGTAATTCTAATGTGTAGCCAGG - Intergenic
1190831391 X:54062212-54062234 AGGTATTCTGATATGCAGCCAGG + Intergenic
1192343541 X:70282682-70282704 AAGCATTGGGAAGTGGAGCCAGG + Intronic
1193171708 X:78344907-78344929 AAGCTTTCTGATGTGCTGCTGGG - Intergenic
1193341601 X:80355206-80355228 AAGCACTTTGATGGGTAGCTGGG + Intronic
1193494999 X:82200227-82200249 AAGCTTTTTGATGTGTTGCTGGG + Intergenic
1195196341 X:102500938-102500960 GAGCCCACTGATGTGTAGCCTGG - Intergenic
1197251919 X:124225870-124225892 AATCAGTCTGATATGTTGCCTGG + Intronic
1197994494 X:132358351-132358373 AAAAATACTGATGTGAAGCCAGG + Intergenic