ID: 1113987242

View in Genome Browser
Species Human (GRCh38)
Location 13:114328036-114328058
Sequence TGCCTCACTTGAGGGAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113987234_1113987242 25 Left 1113987234 13:114327988-114328010 CCATGTTGGCCAGGCTGGTCTCG 0: 41152
1: 148774
2: 216238
3: 150377
4: 68591
Right 1113987242 13:114328036-114328058 TGCCTCACTTGAGGGAGTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 149
1113987235_1113987242 16 Left 1113987235 13:114327997-114328019 CCAGGCTGGTCTCGAACTCTTGG 0: 563
1: 15611
2: 116445
3: 222904
4: 218260
Right 1113987242 13:114328036-114328058 TGCCTCACTTGAGGGAGTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113987242 Original CRISPR TGCCTCACTTGAGGGAGTGC TGG Intergenic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
904388866 1:30165994-30166016 TGCCTCCCTTGAGGGACCTCAGG + Intergenic
904889050 1:33764256-33764278 TGCCAGAGTTGAGGGAGTCCAGG - Intronic
906242512 1:44250715-44250737 TGCCCCCCCTGAGGAAGTGCTGG - Intronic
906323577 1:44830955-44830977 TGCCTCCCTTGAGGGCTTCCGGG - Exonic
907515461 1:54990795-54990817 TGCCTCACAGGACAGAGTGCAGG - Intronic
908389195 1:63669898-63669920 TGCCTGACTTGAAGGGGTTCTGG + Intergenic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
915808571 1:158880877-158880899 TACCTCAGTTGAGGAAGTGTTGG - Intergenic
915813321 1:158939228-158939250 TACCTCAGTTGAGGAAGTGTTGG - Exonic
917612368 1:176701625-176701647 TGCATCAGCTGAGGGAGTGGAGG + Intronic
919742845 1:200991027-200991049 AGCCTCAGATGAGGTAGTGCTGG + Exonic
920304746 1:205011311-205011333 TGCCTTAAGTGAGGGAGGGCAGG + Intronic
921176511 1:212599867-212599889 TGCCTCACCTGAGGCAGGGCTGG - Intronic
1063093357 10:2887564-2887586 TGTCTCCCGTGAGGGAGTGGCGG + Intergenic
1063179250 10:3582660-3582682 TGGCTCACTTGAGGCACTGCTGG - Intergenic
1063608489 10:7543447-7543469 GGCCTCCCTTGGGGGAGTGTTGG + Intergenic
1065999676 10:31092531-31092553 TTTCTCTCTTGAGGTAGTGCAGG + Intergenic
1067523045 10:47022400-47022422 TGCCTGACGGGAGGGAGAGCAGG + Intergenic
1072727068 10:97821454-97821476 TGCCTCCCTTGAGGGAGGACAGG + Intergenic
1073315362 10:102576957-102576979 TGCCTCAGCTGTGGGATTGCAGG + Intronic
1074448201 10:113537771-113537793 TGCCTGGGTTGAGGGAGGGCAGG - Intergenic
1076346381 10:129781513-129781535 TGCCTCACCTGAGGAAAAGCAGG + Intergenic
1077034515 11:488281-488303 TGCCCAACTTCAGCGAGTGCTGG + Exonic
1080042249 11:27771076-27771098 TGTCTCATTTGAGGTACTGCAGG + Intergenic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1083328808 11:61887339-61887361 GGCCTCCCTTGGGGGAGGGCAGG + Intronic
1083696859 11:64449020-64449042 TGCCTCGCTTGGGGTGGTGCTGG + Intergenic
1084051397 11:66602538-66602560 TGCCTCCCTTGAGTGTGGGCTGG - Intronic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1089343093 11:117772935-117772957 TGACCCACTTGAGGGAGTGGAGG + Intronic
1091016378 11:132054763-132054785 TGAATCTCTTGAGGGAGTACTGG + Intronic
1091551185 12:1536019-1536041 TGCGTCACCTGAGGTAGGGCAGG + Intronic
1091999268 12:5019234-5019256 TTCCTCACATGAGAGAGTACAGG + Intergenic
1092167549 12:6352042-6352064 TGCCTGGCTTGAGTGAGTACAGG + Intronic
1093762189 12:22923063-22923085 AGCAACACTTGAGGGAGAGCAGG + Intergenic
1095267172 12:40174135-40174157 TTCCCCACTTGAGGGAGAGTTGG + Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1106220439 13:27742326-27742348 TGGCTCACTTGGGTGAGTGTGGG + Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1109380199 13:61549718-61549740 TGCATTACTGGAGGGATTGCAGG + Intergenic
1113987242 13:114328036-114328058 TGCCTCACTTGAGGGAGTGCTGG + Intergenic
1115634383 14:35277315-35277337 TGCCTCATTTCAGGCTGTGCGGG - Intronic
1118355342 14:65008990-65009012 TGCAGGACTTGAGGGGGTGCAGG - Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1125767312 15:42144374-42144396 TGGCTCACTGGAGCCAGTGCTGG - Intronic
1129321344 15:74776843-74776865 TGCCTGACCTGCGGGAGAGCAGG - Intergenic
1130960399 15:88655145-88655167 TGCCTCCCTTGCGGGACTGCAGG + Intronic
1134455107 16:14389701-14389723 TGCCTCAGTTGAGTGAATGATGG - Intergenic
1136055012 16:27681824-27681846 ACCCTCACTTGGGGGAGGGCTGG + Intronic
1137353229 16:47732927-47732949 TGCCCCACAGGAGGGGGTGCAGG + Intergenic
1138539758 16:57680648-57680670 TGCCTCCCTTGAGGGCGGGAGGG - Intronic
1141506594 16:84482229-84482251 TGCCTCATACGTGGGAGTGCTGG - Intronic
1141586153 16:85034918-85034940 TGCCTCTCCTGAGAAAGTGCAGG + Intronic
1142929580 17:3271243-3271265 TGTCTCACTTAAGGGAGAGGAGG + Intergenic
1143235160 17:5393343-5393365 TGCCTCACCTGACAAAGTGCTGG + Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1146387349 17:32389070-32389092 TCCCTCTCTTGAGGGGGAGCTGG - Intergenic
1148857662 17:50587576-50587598 TGGCTCACTGGAGGGAATACCGG + Intronic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1152379212 17:79933758-79933780 TTGCTCATTTGAGGGTGTGCAGG + Exonic
1152568429 17:81110723-81110745 TGCCTCACTTGCGGGCCTGGAGG - Intronic
1158607989 18:58912862-58912884 TGCCTCTCTCTAGGAAGTGCAGG - Intronic
1159883642 18:73883918-73883940 TGCCTCAGTTCAGGGAGTTTGGG - Intergenic
1160622796 18:80182267-80182289 TGCCACCCTTCAGGGAGGGCTGG - Intronic
1160750678 19:732840-732862 TGCCTCATTCGTGGGAGGGCTGG + Intronic
1161047596 19:2144417-2144439 AGCCTCAGTTGTGGGAGTGGAGG - Intronic
1161645437 19:5450706-5450728 TGCCTCTCTTGCAGGAGTGTGGG + Intergenic
1162744063 19:12789516-12789538 TGACTCACATGAGTGAGTGGGGG + Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163474178 19:17515554-17515576 TGCCCCACTACAGGGAGTGGGGG - Intronic
1163680956 19:18682306-18682328 TCCCTCTCTTGAGGGAGGGAGGG + Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1167484880 19:49756719-49756741 TGCCTCACTTGAGTATGAGCTGG + Intronic
925587175 2:5475502-5475524 TGCCGCCCTTGAGGGAGCGCTGG + Intergenic
932493771 2:72136739-72136761 TGCCTCCCTTCAGAGAGTGATGG + Intronic
933532744 2:83531092-83531114 TCCCTCTGTAGAGGGAGTGCTGG - Intergenic
937224920 2:120363240-120363262 GGCCTCACCTGAGGCAGAGCTGG + Intergenic
945976021 2:216271401-216271423 TGACTCTCTTGGGGGAGTCCAGG - Intronic
946196718 2:218036604-218036626 TGGGTAACTTGAGGGAGTGTTGG - Intronic
946838870 2:223799959-223799981 TGCCCCACTTCGGGAAGTGCTGG - Intronic
947578608 2:231296590-231296612 TTCCTCACCGGTGGGAGTGCTGG + Intronic
947851845 2:233294631-233294653 TACCTCACTTGGGGGAGCACAGG + Exonic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1168919457 20:1518890-1518912 TGCCCCACTTCAGGAAGTGTGGG - Intergenic
1169111876 20:3039494-3039516 TGCCTAACTACAGGGAGTGCTGG + Intergenic
1170663611 20:18365867-18365889 TGGCTCACTTGAGGGGAAGCAGG + Intergenic
1172357422 20:34289979-34290001 AGCCTCAGCTTAGGGAGTGCTGG - Intronic
1172547027 20:35770271-35770293 TGCCTCAGTTGAGGTAGTCAGGG - Intergenic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1176156172 20:63622313-63622335 TGCCTCCCCTTAGTGAGTGCAGG - Intronic
1177336592 21:19736241-19736263 AGCCACACTTGAGGTAGTGAGGG - Intergenic
1179776915 21:43670567-43670589 TGCCTCTGTAGAGGGAGAGCAGG + Intronic
1182736940 22:32537457-32537479 AGCCCCACTTAAGGAAGTGCCGG - Intronic
950746141 3:15090963-15090985 TGCCTCCCTTGTGGGATTACAGG - Intronic
954553526 3:51501357-51501379 TGCCCCACAAGAGGGACTGCTGG - Intergenic
954794463 3:53154521-53154543 TACCTCTCTGGAGGGAGAGCTGG - Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
961419927 3:126795050-126795072 TGCCTCTCCTGAGGGGCTGCAGG + Intronic
963294651 3:143532808-143532830 TGGGTCACTTGAGGGACTGAAGG - Intronic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
966670925 3:182524943-182524965 TGCCTCACCTGCGGAAGAGCGGG - Intergenic
968805846 4:2771971-2771993 TACCACACTTGGGGGGGTGCAGG - Intergenic
969235172 4:5860402-5860424 TTTCTCATTTGAGGGTGTGCAGG - Intronic
969854885 4:9991124-9991146 AGCCTCACTTGGGGGAGCTCTGG - Intronic
970359519 4:15294605-15294627 TTCCTGATTTGAGGGAGTTCAGG + Intergenic
970515610 4:16827094-16827116 TGCCACACTTAAAGGAGTGCTGG + Intronic
970551250 4:17183783-17183805 TGCCTTACTTGAGGAAATGCTGG + Intergenic
976926080 4:90497891-90497913 TTCTTCTCATGAGGGAGTGCAGG + Intronic
982306434 4:153936320-153936342 TGCTTCAGCTGAGGGAGGGCTGG + Intergenic
984414399 4:179438174-179438196 CCCCTCACTTCAGAGAGTGCAGG - Intergenic
985665339 5:1179227-1179249 AGCCTCACCTGAGGGAGAGCTGG - Intergenic
987794013 5:22605379-22605401 TGCCTCTCATGAGGGACTGATGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1006003687 6:30986549-30986571 GGCCCCACTGGAGGGTGTGCTGG - Exonic
1006003703 6:30986639-30986661 GGCCTCACTGGAGGTTGTGCTGG - Exonic
1006003755 6:30986909-30986931 GGCCCCACTGGAGGGTGTGCTGG - Exonic
1006003781 6:30987044-30987066 GGCCCCACTGGAGGGTGTGCTGG - Exonic
1006356549 6:33562278-33562300 AGCCTCACTTGAGTGAGCGTGGG - Intergenic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1010395320 6:75385365-75385387 GGGCGCACTTGAAGGAGTGCTGG + Intronic
1012267465 6:97163359-97163381 TAACTCAGATGAGGGAGTGCAGG + Intronic
1016202822 6:141433230-141433252 TGCCTTACTTGAAAGAGAGCAGG - Intergenic
1018712805 6:166508749-166508771 TTCCTCTCTTGAGGCAGTTCTGG + Intronic
1019703810 7:2488042-2488064 GGCCTCTCTTAAGGGAGTACTGG - Intergenic
1022855681 7:34311270-34311292 TACCTCACTTTAGGCTGTGCTGG + Intergenic
1029664494 7:101986445-101986467 TGACTCACTTAAGAGAGAGCTGG + Intronic
1032167439 7:129556545-129556567 TGCGTGACTTGTGGGAATGCAGG + Intergenic
1033288183 7:140060440-140060462 TGACTCACTTTAGGGAGAGTGGG - Intronic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1035112362 7:156493816-156493838 ACCCTCACTTGAGTGAGTGAGGG - Intergenic
1037876927 8:22552929-22552951 TGCCTGACTGGGGGGAGTGGAGG - Intronic
1037982112 8:23261666-23261688 TGCCTCCTTTGAGGGACTGGGGG + Exonic
1039466640 8:37789315-37789337 TGCCTTGCTGGAGGGAGTACAGG - Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1044341522 8:91051342-91051364 TATCTCACTGGAGGAAGTGCTGG - Intergenic
1045024676 8:98075551-98075573 TGCCTAACCTGAGAGAGTGGTGG + Intronic
1045648444 8:104321594-104321616 TACCTCACTTTAGAGAGTGAGGG + Intergenic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1055628252 9:78196057-78196079 TGACTCACTTCAGGGACTTCTGG - Intergenic
1055756824 9:79567208-79567230 AGCCTCATTTGAGGAAGTGTTGG - Intergenic
1057302781 9:93896296-93896318 TGCCTCCTGAGAGGGAGTGCTGG + Intergenic
1059242586 9:112819876-112819898 CGCCTGACTTGAGGTAGTGCTGG + Intronic
1061780141 9:132991032-132991054 AGCCTCACTTGAGATTGTGCTGG - Exonic
1061908630 9:133711471-133711493 TTCCTCGCTTGGGAGAGTGCAGG + Intronic
1062308404 9:135922191-135922213 TGCCCCTCCTGAGGGGGTGCAGG - Intergenic
1062467707 9:136688298-136688320 TGCTGCAGTTGCGGGAGTGCTGG + Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1187302697 X:18066298-18066320 TGCCTCAATTAAGGGACTGGGGG + Intergenic
1189346476 X:40245573-40245595 TCTTTCACTTGAGGGAGGGCAGG + Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1195247292 X:103005922-103005944 TGCCTTACCTGAGAGAGAGCAGG + Intergenic
1199196491 X:145037304-145037326 TGCAGCAGTTAAGGGAGTGCTGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1200827992 Y:7662978-7663000 TGCCAAACTTCTGGGAGTGCAGG - Intergenic
1201428291 Y:13878603-13878625 TCCCTATATTGAGGGAGTGCTGG + Intergenic