ID: 1113989971

View in Genome Browser
Species Human (GRCh38)
Location 13:114353410-114353432
Sequence CAAAGGCGGCGCGCCGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113989971_1113989979 28 Left 1113989971 13:114353410-114353432 CCTGCGCCGGCGCGCCGCCTTTG No data
Right 1113989979 13:114353461-114353483 CACACCCGGAGAGCATCGCGAGG No data
1113989971_1113989980 29 Left 1113989971 13:114353410-114353432 CCTGCGCCGGCGCGCCGCCTTTG No data
Right 1113989980 13:114353462-114353484 ACACCCGGAGAGCATCGCGAGGG No data
1113989971_1113989978 14 Left 1113989971 13:114353410-114353432 CCTGCGCCGGCGCGCCGCCTTTG No data
Right 1113989978 13:114353447-114353469 CGTTCTCTTTAGCACACACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113989971 Original CRISPR CAAAGGCGGCGCGCCGGCGC AGG (reversed) Intergenic
No off target data available for this crispr