ID: 1113990222

View in Genome Browser
Species Human (GRCh38)
Location 14:16022893-16022915
Sequence GTGTGGGTATTGTGAGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113990217_1113990222 12 Left 1113990217 14:16022858-16022880 CCACGGGCGGGTCCTCGTTGGGA No data
Right 1113990222 14:16022893-16022915 GTGTGGGTATTGTGAGAAAAAGG No data
1113990210_1113990222 25 Left 1113990210 14:16022845-16022867 CCTGTCCCGTTGGCCACGGGCGG No data
Right 1113990222 14:16022893-16022915 GTGTGGGTATTGTGAGAAAAAGG No data
1113990218_1113990222 0 Left 1113990218 14:16022870-16022892 CCTCGTTGGGACAAGCGACGATG No data
Right 1113990222 14:16022893-16022915 GTGTGGGTATTGTGAGAAAAAGG No data
1113990214_1113990222 19 Left 1113990214 14:16022851-16022873 CCGTTGGCCACGGGCGGGTCCTC No data
Right 1113990222 14:16022893-16022915 GTGTGGGTATTGTGAGAAAAAGG No data
1113990213_1113990222 20 Left 1113990213 14:16022850-16022872 CCCGTTGGCCACGGGCGGGTCCT No data
Right 1113990222 14:16022893-16022915 GTGTGGGTATTGTGAGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113990222 Original CRISPR GTGTGGGTATTGTGAGAAAA AGG Intergenic
No off target data available for this crispr