ID: 1113991796

View in Genome Browser
Species Human (GRCh38)
Location 14:16033763-16033785
Sequence GGTTCCAGACAACCACAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113991796_1113991800 7 Left 1113991796 14:16033763-16033785 CCTTATTGTGGTTGTCTGGAACC No data
Right 1113991800 14:16033793-16033815 CTATCTCTGAGAATGCTTGTAGG No data
1113991796_1113991801 14 Left 1113991796 14:16033763-16033785 CCTTATTGTGGTTGTCTGGAACC No data
Right 1113991801 14:16033800-16033822 TGAGAATGCTTGTAGGTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113991796 Original CRISPR GGTTCCAGACAACCACAATA AGG (reversed) Intergenic
No off target data available for this crispr