ID: 1113992913

View in Genome Browser
Species Human (GRCh38)
Location 14:16042478-16042500
Sequence ACGTGGGTAGTGGGGGGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113992913_1113992924 8 Left 1113992913 14:16042478-16042500 CCGGCTCCCCCCACTACCCACGT No data
Right 1113992924 14:16042509-16042531 CTTCATTTAGTGAGTCAGTTAGG No data
1113992913_1113992926 12 Left 1113992913 14:16042478-16042500 CCGGCTCCCCCCACTACCCACGT No data
Right 1113992926 14:16042513-16042535 ATTTAGTGAGTCAGTTAGGTGGG No data
1113992913_1113992925 11 Left 1113992913 14:16042478-16042500 CCGGCTCCCCCCACTACCCACGT No data
Right 1113992925 14:16042512-16042534 CATTTAGTGAGTCAGTTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113992913 Original CRISPR ACGTGGGTAGTGGGGGGAGC CGG (reversed) Intergenic
No off target data available for this crispr