ID: 1113993177

View in Genome Browser
Species Human (GRCh38)
Location 14:16045126-16045148
Sequence GATACCTCTGCATTGGCCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113993171_1113993177 -1 Left 1113993171 14:16045104-16045126 CCTGTCCCACCGAGGTCAAATGG No data
Right 1113993177 14:16045126-16045148 GATACCTCTGCATTGGCCCGAGG No data
1113993175_1113993177 -10 Left 1113993175 14:16045113-16045135 CCGAGGTCAAATGGATACCTCTG No data
Right 1113993177 14:16045126-16045148 GATACCTCTGCATTGGCCCGAGG No data
1113993173_1113993177 -6 Left 1113993173 14:16045109-16045131 CCCACCGAGGTCAAATGGATACC No data
Right 1113993177 14:16045126-16045148 GATACCTCTGCATTGGCCCGAGG No data
1113993174_1113993177 -7 Left 1113993174 14:16045110-16045132 CCACCGAGGTCAAATGGATACCT No data
Right 1113993177 14:16045126-16045148 GATACCTCTGCATTGGCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113993177 Original CRISPR GATACCTCTGCATTGGCCCG AGG Intergenic
No off target data available for this crispr