ID: 1113996768

View in Genome Browser
Species Human (GRCh38)
Location 14:16090481-16090503
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113996768_1113996770 25 Left 1113996768 14:16090481-16090503 CCAATCAAAAGAAAGTTCACCTC No data
Right 1113996770 14:16090529-16090551 GAAAGTTTCTCAGAAAGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113996768 Original CRISPR GAGGTGAACTTTCTTTTGAT TGG (reversed) Intergenic
No off target data available for this crispr