ID: 1114007721

View in Genome Browser
Species Human (GRCh38)
Location 14:18332655-18332677
Sequence GGCGCGAGCCAAGGAAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114007712_1114007721 26 Left 1114007712 14:18332606-18332628 CCCATACTGGCGACTGCACAGTC No data
Right 1114007721 14:18332655-18332677 GGCGCGAGCCAAGGAAGAGCAGG No data
1114007716_1114007721 2 Left 1114007716 14:18332630-18332652 CCAGAGTCTGCAAACCAGCGCTC No data
Right 1114007721 14:18332655-18332677 GGCGCGAGCCAAGGAAGAGCAGG No data
1114007714_1114007721 4 Left 1114007714 14:18332628-18332650 CCCCAGAGTCTGCAAACCAGCGC No data
Right 1114007721 14:18332655-18332677 GGCGCGAGCCAAGGAAGAGCAGG No data
1114007715_1114007721 3 Left 1114007715 14:18332629-18332651 CCCAGAGTCTGCAAACCAGCGCT No data
Right 1114007721 14:18332655-18332677 GGCGCGAGCCAAGGAAGAGCAGG No data
1114007711_1114007721 27 Left 1114007711 14:18332605-18332627 CCCCATACTGGCGACTGCACAGT No data
Right 1114007721 14:18332655-18332677 GGCGCGAGCCAAGGAAGAGCAGG No data
1114007713_1114007721 25 Left 1114007713 14:18332607-18332629 CCATACTGGCGACTGCACAGTCC No data
Right 1114007721 14:18332655-18332677 GGCGCGAGCCAAGGAAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114007721 Original CRISPR GGCGCGAGCCAAGGAAGAGC AGG Intergenic
No off target data available for this crispr