ID: 1114020971

View in Genome Browser
Species Human (GRCh38)
Location 14:18478353-18478375
Sequence ATGTGTCTCTAACATTCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114020966_1114020971 11 Left 1114020966 14:18478319-18478341 CCCTCAGAAACCAGCAGCAGTGT No data
Right 1114020971 14:18478353-18478375 ATGTGTCTCTAACATTCTGAGGG No data
1114020969_1114020971 1 Left 1114020969 14:18478329-18478351 CCAGCAGCAGTGTTCTGGAATTC No data
Right 1114020971 14:18478353-18478375 ATGTGTCTCTAACATTCTGAGGG No data
1114020967_1114020971 10 Left 1114020967 14:18478320-18478342 CCTCAGAAACCAGCAGCAGTGTT No data
Right 1114020971 14:18478353-18478375 ATGTGTCTCTAACATTCTGAGGG No data
1114020965_1114020971 28 Left 1114020965 14:18478302-18478324 CCTATGTGAGGGACAAACCCTCA No data
Right 1114020971 14:18478353-18478375 ATGTGTCTCTAACATTCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114020971 Original CRISPR ATGTGTCTCTAACATTCTGA GGG Intergenic
No off target data available for this crispr