ID: 1114024424

View in Genome Browser
Species Human (GRCh38)
Location 14:18511968-18511990
Sequence CAGAAACAGCAGCAGTGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114024424_1114024425 -6 Left 1114024424 14:18511968-18511990 CCAGAACACTGCTGCTGTTTCTG No data
Right 1114024425 14:18511985-18512007 TTTCTGTTTGTCCCTCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114024424 Original CRISPR CAGAAACAGCAGCAGTGTTC TGG (reversed) Intergenic
No off target data available for this crispr