ID: 1114031530

View in Genome Browser
Species Human (GRCh38)
Location 14:18584240-18584262
Sequence CGCAGCCGCCAGGGAGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114031530_1114031538 -4 Left 1114031530 14:18584240-18584262 CCAGTCCCTCCCTGGCGGCTGCG No data
Right 1114031538 14:18584259-18584281 TGCGGAGCCGTCCGAGGACAGGG No data
1114031530_1114031539 -3 Left 1114031530 14:18584240-18584262 CCAGTCCCTCCCTGGCGGCTGCG No data
Right 1114031539 14:18584260-18584282 GCGGAGCCGTCCGAGGACAGGGG No data
1114031530_1114031543 18 Left 1114031530 14:18584240-18584262 CCAGTCCCTCCCTGGCGGCTGCG No data
Right 1114031543 14:18584281-18584303 GGCCATAAACTCTCCAGAGCGGG No data
1114031530_1114031537 -5 Left 1114031530 14:18584240-18584262 CCAGTCCCTCCCTGGCGGCTGCG No data
Right 1114031537 14:18584258-18584280 CTGCGGAGCCGTCCGAGGACAGG No data
1114031530_1114031542 17 Left 1114031530 14:18584240-18584262 CCAGTCCCTCCCTGGCGGCTGCG No data
Right 1114031542 14:18584280-18584302 GGGCCATAAACTCTCCAGAGCGG No data
1114031530_1114031536 -10 Left 1114031530 14:18584240-18584262 CCAGTCCCTCCCTGGCGGCTGCG No data
Right 1114031536 14:18584253-18584275 GGCGGCTGCGGAGCCGTCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114031530 Original CRISPR CGCAGCCGCCAGGGAGGGAC TGG (reversed) Intergenic
No off target data available for this crispr