ID: 1114036080

View in Genome Browser
Species Human (GRCh38)
Location 14:18628907-18628929
Sequence GTGGTATGGCCGTCAAACTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114036080_1114036083 -3 Left 1114036080 14:18628907-18628929 CCGAAGTTTGACGGCCATACCAC No data
Right 1114036083 14:18628927-18628949 CACTATACCATGCTGCCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114036080 Original CRISPR GTGGTATGGCCGTCAAACTT CGG (reversed) Intergenic