ID: 1114036080 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:18628907-18628929 |
Sequence | GTGGTATGGCCGTCAAACTT CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1114036080_1114036083 | -3 | Left | 1114036080 | 14:18628907-18628929 | CCGAAGTTTGACGGCCATACCAC | No data | ||
Right | 1114036083 | 14:18628927-18628949 | CACTATACCATGCTGCCTTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1114036080 | Original CRISPR | GTGGTATGGCCGTCAAACTT CGG (reversed) | Intergenic | ||