ID: 1114036083

View in Genome Browser
Species Human (GRCh38)
Location 14:18628927-18628949
Sequence CACTATACCATGCTGCCTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114036080_1114036083 -3 Left 1114036080 14:18628907-18628929 CCGAAGTTTGACGGCCATACCAC No data
Right 1114036083 14:18628927-18628949 CACTATACCATGCTGCCTTATGG No data
1114036078_1114036083 8 Left 1114036078 14:18628896-18628918 CCTGCTATATGCCGAAGTTTGAC No data
Right 1114036083 14:18628927-18628949 CACTATACCATGCTGCCTTATGG No data
1114036076_1114036083 18 Left 1114036076 14:18628886-18628908 CCTAGGCAACCCTGCTATATGCC No data
Right 1114036083 14:18628927-18628949 CACTATACCATGCTGCCTTATGG No data
1114036077_1114036083 9 Left 1114036077 14:18628895-18628917 CCCTGCTATATGCCGAAGTTTGA No data
Right 1114036083 14:18628927-18628949 CACTATACCATGCTGCCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114036083 Original CRISPR CACTATACCATGCTGCCTTA TGG Intergenic