ID: 1114038505

View in Genome Browser
Species Human (GRCh38)
Location 14:18653152-18653174
Sequence GTGACCACCCAGACTGAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114038500_1114038505 16 Left 1114038500 14:18653113-18653135 CCTGCTTTTATCCTAGCTGTGCT 0: 29
1: 55
2: 167
3: 245
4: 540
Right 1114038505 14:18653152-18653174 GTGACCACCCAGACTGAGAGTGG No data
1114038499_1114038505 22 Left 1114038499 14:18653107-18653129 CCTCTGCCTGCTTTTATCCTAGC 0: 121
1: 131
2: 98
3: 61
4: 225
Right 1114038505 14:18653152-18653174 GTGACCACCCAGACTGAGAGTGG No data
1114038502_1114038505 5 Left 1114038502 14:18653124-18653146 CCTAGCTGTGCTGGCAGCTGATT 0: 31
1: 58
2: 148
3: 189
4: 386
Right 1114038505 14:18653152-18653174 GTGACCACCCAGACTGAGAGTGG No data
1114038498_1114038505 29 Left 1114038498 14:18653100-18653122 CCATATTCCTCTGCCTGCTTTTA 0: 5
1: 97
2: 252
3: 352
4: 859
Right 1114038505 14:18653152-18653174 GTGACCACCCAGACTGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114038505 Original CRISPR GTGACCACCCAGACTGAGAG TGG Intergenic
No off target data available for this crispr