ID: 1114039501

View in Genome Browser
Species Human (GRCh38)
Location 14:18663523-18663545
Sequence AACCCGGAGAAGGGTTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114039501_1114039509 11 Left 1114039501 14:18663523-18663545 CCAGGAAAACCCTTCTCCGGGTT No data
Right 1114039509 14:18663557-18663579 AGCTGTGACCCCTCTGAAGGAGG No data
1114039501_1114039508 8 Left 1114039501 14:18663523-18663545 CCAGGAAAACCCTTCTCCGGGTT No data
Right 1114039508 14:18663554-18663576 GTCAGCTGTGACCCCTCTGAAGG No data
1114039501_1114039510 14 Left 1114039501 14:18663523-18663545 CCAGGAAAACCCTTCTCCGGGTT No data
Right 1114039510 14:18663560-18663582 TGTGACCCCTCTGAAGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114039501 Original CRISPR AACCCGGAGAAGGGTTTTCC TGG (reversed) Intergenic