ID: 1114039503

View in Genome Browser
Species Human (GRCh38)
Location 14:18663532-18663554
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114039503_1114039509 2 Left 1114039503 14:18663532-18663554 CCCTTCTCCGGGTTACCTGGCCG No data
Right 1114039509 14:18663557-18663579 AGCTGTGACCCCTCTGAAGGAGG No data
1114039503_1114039510 5 Left 1114039503 14:18663532-18663554 CCCTTCTCCGGGTTACCTGGCCG No data
Right 1114039510 14:18663560-18663582 TGTGACCCCTCTGAAGGAGGAGG No data
1114039503_1114039508 -1 Left 1114039503 14:18663532-18663554 CCCTTCTCCGGGTTACCTGGCCG No data
Right 1114039508 14:18663554-18663576 GTCAGCTGTGACCCCTCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114039503 Original CRISPR CGGCCAGGTAACCCGGAGAA GGG (reversed) Intergenic