ID: 1114039505

View in Genome Browser
Species Human (GRCh38)
Location 14:18663539-18663561
Sequence CAGCTGACGGCCAGGTAACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114039505_1114039508 -8 Left 1114039505 14:18663539-18663561 CCGGGTTACCTGGCCGTCAGCTG No data
Right 1114039508 14:18663554-18663576 GTCAGCTGTGACCCCTCTGAAGG No data
1114039505_1114039510 -2 Left 1114039505 14:18663539-18663561 CCGGGTTACCTGGCCGTCAGCTG No data
Right 1114039510 14:18663560-18663582 TGTGACCCCTCTGAAGGAGGAGG No data
1114039505_1114039509 -5 Left 1114039505 14:18663539-18663561 CCGGGTTACCTGGCCGTCAGCTG No data
Right 1114039509 14:18663557-18663579 AGCTGTGACCCCTCTGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114039505 Original CRISPR CAGCTGACGGCCAGGTAACC CGG (reversed) Intergenic