ID: 1114039508

View in Genome Browser
Species Human (GRCh38)
Location 14:18663554-18663576
Sequence GTCAGCTGTGACCCCTCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114039504_1114039508 -2 Left 1114039504 14:18663533-18663555 CCTTCTCCGGGTTACCTGGCCGT No data
Right 1114039508 14:18663554-18663576 GTCAGCTGTGACCCCTCTGAAGG No data
1114039500_1114039508 9 Left 1114039500 14:18663522-18663544 CCCAGGAAAACCCTTCTCCGGGT No data
Right 1114039508 14:18663554-18663576 GTCAGCTGTGACCCCTCTGAAGG No data
1114039501_1114039508 8 Left 1114039501 14:18663523-18663545 CCAGGAAAACCCTTCTCCGGGTT No data
Right 1114039508 14:18663554-18663576 GTCAGCTGTGACCCCTCTGAAGG No data
1114039505_1114039508 -8 Left 1114039505 14:18663539-18663561 CCGGGTTACCTGGCCGTCAGCTG No data
Right 1114039508 14:18663554-18663576 GTCAGCTGTGACCCCTCTGAAGG No data
1114039498_1114039508 10 Left 1114039498 14:18663521-18663543 CCCCAGGAAAACCCTTCTCCGGG No data
Right 1114039508 14:18663554-18663576 GTCAGCTGTGACCCCTCTGAAGG No data
1114039503_1114039508 -1 Left 1114039503 14:18663532-18663554 CCCTTCTCCGGGTTACCTGGCCG No data
Right 1114039508 14:18663554-18663576 GTCAGCTGTGACCCCTCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114039508 Original CRISPR GTCAGCTGTGACCCCTCTGA AGG Intergenic