ID: 1114039510

View in Genome Browser
Species Human (GRCh38)
Location 14:18663560-18663582
Sequence TGTGACCCCTCTGAAGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114039506_1114039510 -10 Left 1114039506 14:18663547-18663569 CCTGGCCGTCAGCTGTGACCCCT No data
Right 1114039510 14:18663560-18663582 TGTGACCCCTCTGAAGGAGGAGG No data
1114039500_1114039510 15 Left 1114039500 14:18663522-18663544 CCCAGGAAAACCCTTCTCCGGGT No data
Right 1114039510 14:18663560-18663582 TGTGACCCCTCTGAAGGAGGAGG No data
1114039498_1114039510 16 Left 1114039498 14:18663521-18663543 CCCCAGGAAAACCCTTCTCCGGG No data
Right 1114039510 14:18663560-18663582 TGTGACCCCTCTGAAGGAGGAGG No data
1114039504_1114039510 4 Left 1114039504 14:18663533-18663555 CCTTCTCCGGGTTACCTGGCCGT No data
Right 1114039510 14:18663560-18663582 TGTGACCCCTCTGAAGGAGGAGG No data
1114039501_1114039510 14 Left 1114039501 14:18663523-18663545 CCAGGAAAACCCTTCTCCGGGTT No data
Right 1114039510 14:18663560-18663582 TGTGACCCCTCTGAAGGAGGAGG No data
1114039505_1114039510 -2 Left 1114039505 14:18663539-18663561 CCGGGTTACCTGGCCGTCAGCTG No data
Right 1114039510 14:18663560-18663582 TGTGACCCCTCTGAAGGAGGAGG No data
1114039503_1114039510 5 Left 1114039503 14:18663532-18663554 CCCTTCTCCGGGTTACCTGGCCG No data
Right 1114039510 14:18663560-18663582 TGTGACCCCTCTGAAGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114039510 Original CRISPR TGTGACCCCTCTGAAGGAGG AGG Intergenic