ID: 1114042987

View in Genome Browser
Species Human (GRCh38)
Location 14:18695985-18696007
Sequence CCTGAGAAGAAGGAGCGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114042982_1114042987 16 Left 1114042982 14:18695946-18695968 CCTAATTTCAATACTGTTGTGTA No data
Right 1114042987 14:18695985-18696007 CCTGAGAAGAAGGAGCGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114042987 Original CRISPR CCTGAGAAGAAGGAGCGAGC TGG Intergenic
No off target data available for this crispr