ID: 1114043247

View in Genome Browser
Species Human (GRCh38)
Location 14:18699527-18699549
Sequence CCATCCAGGAAAACACTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114043240_1114043247 8 Left 1114043240 14:18699496-18699518 CCCCAAATCTCCAAGCTTGACGT No data
Right 1114043247 14:18699527-18699549 CCATCCAGGAAAACACTGGCTGG No data
1114043243_1114043247 -2 Left 1114043243 14:18699506-18699528 CCAAGCTTGACGTTTTGCTTGCC No data
Right 1114043247 14:18699527-18699549 CCATCCAGGAAAACACTGGCTGG No data
1114043242_1114043247 6 Left 1114043242 14:18699498-18699520 CCAAATCTCCAAGCTTGACGTTT No data
Right 1114043247 14:18699527-18699549 CCATCCAGGAAAACACTGGCTGG No data
1114043241_1114043247 7 Left 1114043241 14:18699497-18699519 CCCAAATCTCCAAGCTTGACGTT No data
Right 1114043247 14:18699527-18699549 CCATCCAGGAAAACACTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114043247 Original CRISPR CCATCCAGGAAAACACTGGC TGG Intergenic
No off target data available for this crispr