ID: 1114047278

View in Genome Browser
Species Human (GRCh38)
Location 14:18886425-18886447
Sequence CCTGAGAAGAAGGAGCGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114047273_1114047278 16 Left 1114047273 14:18886386-18886408 CCTAATTTCAATATTGTTGTGTA No data
Right 1114047278 14:18886425-18886447 CCTGAGAAGAAGGAGCGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114047278 Original CRISPR CCTGAGAAGAAGGAGCGAGC TGG Intergenic
No off target data available for this crispr